View Single Post
Old 12-13-2018, 08:44 AM   #1
Tsequencing
Junior Member
 
Location: Europe

Join Date: Dec 2018
Posts: 4
Default Multiple indexes per sample how to trim with Trimmomatic?!

Hi all,

I received my HiSeq Illumina RNAseq data and want to run trimmomatic to remove bad quality reads and trim adapters. I have used trimmomatic before but I am currently in doubt if I create the adapter file in a correct way, can someone please correct me if I'm wrong?

Sequencing happened on Illumina HiSeq4000 using NEBnext kit for the library construction.

From the sequencing facility I have received the adapter and index sequences (e.g for my first sample):

Adapter:

5' Adapter: 5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3'

3' Adapter(lowercase 6bp bases is Index) 5'-GATCGGAAGAGCACACGTCTGAACTCCAGTCACatcacgATCTCGTATGCCGTCTTCTGCTTG-3

index:
CTGGCATA;CGGCTATG

- I do not understand why I receive two indexes for a single sample? A single sample, needs only one adapter with one specific index? Correct?

- Trimmomatic needs an adapter file and I will create as follows (with all adapters and indeces in a single file):

>Prefix_AdapterPE1/1
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
>Prefix_AdapterPE1/2
GATCGGAAGAGCACACGTCTGAACTCCAGTCACctggcataATCTCGTATGCCGTCTTCTGCTTG

With the index in capitals also, but just to show that I will manually add the index sequence. I will do this for all received index sequences, added to a single adapter file and will finally run Trimmomatic.

Any comments are welcome!
Tsequencing is offline   Reply With Quote