View Single Post
Old 02-02-2011, 12:30 PM   #2
seb567
Senior Member
 
Location: Québec, Canada

Join Date: Jul 2008
Posts: 260
Default

Quote:
Originally Posted by khunny7 View Post
I am new to this field and this probably a very ignorant question.
However, when I did a blast search with following sequence, "TGTCTTTGGACATGTAAGAATTGGAGGAAAATAAATGTGGATTTGGGAAACTTTGAGG" blast returned me this following result. As seen in the result, matched sequences are in same chromosome yet seemed to have different indices. Thus thinking those are repeated regions, I was trying to locate those. However, I could find only one not even two. My assumption is that those numbers are not really indices. Can anyone help me to understand this problem? Thank you.


>ref|NT_167247.1| Homo sapiens chromosome 6 genomic contig, GRCh37.p2 reference
assembly alternate locus group ALT_REF_LOCI_5
Length=4833398


Features in this part of subject sequence:
large proline-rich protein BAT2

Score = 108 bits (58), Expect = 7e-22
Identities = 58/58 (100%), Gaps = 0/58 (0%)
Strand=Plus/Plus

Query 1 TGTCTTTGGACATGTAAGAATTGGAGGAAAATAAATGTGGATTTGGGAAACTTTGAGG 58
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 2970579 TGTCTTTGGACATGTAAGAATTGGAGGAAAATAAATGTGGATTTGGGAAACTTTGAGG 2970636


>ref|NT_167245.1| Homo sapiens chromosome 6 genomic contig, GRCh37.p2 reference
assembly alternate locus group ALT_REF_LOCI_3
Length=4610396


Features in this part of subject sequence:
large proline-rich protein BAT2

Score = 108 bits (58), Expect = 7e-22
Identities = 58/58 (100%), Gaps = 0/58 (0%)
Strand=Plus/Plus

Query 1 TGTCTTTGGACATGTAAGAATTGGAGGAAAATAAATGTGGATTTGGGAAACTTTGAGG 58
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 2876461 TGTCTTTGGACATGTAAGAATTGGAGGAAAATAAATGTGGATTTGGGAAACTTTGAGG 2876518


>ref|NT_113891.2| Homo sapiens chromosome 6 genomic contig, GRCh37.p2 reference
assembly alternate locus group ALT_REF_LOCI_2
Length=4795371


Features in this part of subject sequence:
large proline-rich protein BAT2

Score = 102 bits (55), Expect = 3e-20
Identities = 57/58 (99%), Gaps = 0/58 (0%)
Strand=Plus/Plus

Query 1 TGTCTTTGGACATGTAAGAATTGGAGGAAAATAAATGTGGATTTGGGAAACTTTGAGG 58
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct 3100500 TGTCTTTGGACACGTAAGAATTGGAGGAAAATAAATGTGGATTTGGGAAACTTTGAGG 3100557

The numbers you carefully colored in red are chromosome positions.

They are starting positions for the alignments.

-seb

Last edited by seb567; 02-02-2011 at 12:31 PM. Reason: typographical error
seb567 is offline   Reply With Quote