View Single Post
Old 10-25-2021, 01:48 AM   #1
abubd
Junior Member
 
Location: Sweden

Join Date: Oct 2021
Posts: 2
Default mapping with bbmap anderror

I am having a problem when mapping my short reads 150bp (paired-end reads) to the genome fasta.

I would like to have all unique reads (no mismatching, minimum reads 150 bp) out that are mapped to the genome.

Here I face the problem: I assigned 20 threads (20 cores) but my job ended up with error. Why it is happening and what is the solution?. Each file 23 GB big (R1 and R2)

Code:
job starting at 09:42:42
java -ea -Xmx60001m -Xms60001m -cp /sw/bioinfo/bbmap/38.61b/rackham/current/ align2.BBMap build=1 overwrite=true fastareadlen=500 pairedonly=t ambiguous=toss killbadpairs=t pairlen=1000 trimq=20 mintrimlength=120 minaveragequality=20 rescuemismatches=1 outm=2008-27-201.aligned.sam outu=2008-27-201.unaligned.sam showprogress=10000 scafstats=2008_27.scafstats in=/crex/proj/snic2020-6-16/datasets/human_depleted/Ki-2008-27-201_unmapped_R1.fq.gz in2=/crex/proj/snic2020-6-16/datasets/human_depleted/Ki-2008-27-201_unmapped_R2.fq.gz threads=auto
Executing align2.BBMap [build=1, overwrite=true, fastareadlen=500, pairedonly=t, ambiguous=toss, killbadpairs=t, pairlen=1000, trimq=20, mintrimlength=120, minaveragequality=20, rescuemismatches=1, outm=2008-27-201.aligned.sam, outu=2008-27-201.unaligned.sam, showprogress=10000, scafstats=2008_27.scafstats, in=/crex/proj/snic2020-6-16/datasets/human_depleted/Ki-2008-27-201_unmapped_R1.fq.gz, in2=/crex/proj/snic2020-6-16/datasets/human_depleted/Ki-2008-27-201_unmapped_R2.fq.gz, threads=auto]
Version 38.61

Scaffold statistics will be written to 2008_27.scafstats
Set threads to 20
Ambiguously mapped reads will be considered unmapped.
Set genome to 1

Loaded Reference:       2.025 seconds.
Loading index for chunk 1-1, build 1
Generated Index:        3.261 seconds.
Analyzed Index:         2.517 seconds.
Started output stream:  0.371 seconds.
Started output stream:  0.023 seconds.
Creating scaffold statistics table:     0.065 seconds.
Cleared Memory:         0.516 seconds.
Processing reads in paired-ended mode.
Started read stream.
Started 20 mapping threads.
Exception in thread "Thread-6" java.lang.AssertionError: A00605:23:HHNVHDSXX:1:1101:13711:1783 1:N:0:TAATGCGC+AGGCGAAG  0       -1      +       -1      -1      00000000000000000000000 1       0       0       ATGTTGAATATGCTTTGTTTTATGTTATAATCAGGTGCTATTTAATTGTTTGACTGTTGGTGATTGCAGGTTTTGGAGAAAAGGAGGAGCTCATCCAGATCAACAAAGCTTGGACTTCTACAACAGCGTTTGGACAAAGGTAAGAACGAAA FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF .       .       .       .
        at align2.AbstractMapThread.rescue(AbstractMapThread.java:1200)
        at align2.BBMapThread.processReadPair(BBMapThread.java:1097)
        at align2.AbstractMapThread.run(AbstractMapThread.java:536)
Detecting finished threads: 0Exception in thread "Thread-18" java.lang.AssertionError: A00605:23:HHNVHDSXX:1:1101:16107:1705 2:N:0:TAATGCGC+AGGCGAAG    601     -1      +       -1      -1      00000000001000000000000 1       0       0       CCGACCCTCCAAGAGTGTCTGGTATGTGTGGCTGAATTCTGGGTCGCTTTTGTAGAGAAGTGGCCAATCAGAAGTCTCGTGCCCGCAAGAGTTGAGCACGGTGGTTAGCGCCATGATCGGTGGTCGACTGAGGCAATCTGCAACATTATTG FFFFFFFFFFFFFFF:FFFFFFF,FFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF,FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFF:FF,FFF .       .       .       .       1,1,28300816,28300966,0,00,14,14532,14556,14557,145561,1,28300816,28300966,0,00,14,14532,14556,14557,14556
        at align2.AbstractMapThread.rescue(AbstractMapThread.java:1200)
        at align2.BBMapThread.processReadPair(BBMapThread.java:1090)
        at align2.AbstractMapThread.run(AbstractMapThread.java:536)
Exception in thread "Thread-24" java.lang.AssertionError: A00605:23:HHNVHDSXX:1:1101:8558:1626 1:N:0:TAATGCGC+AGGCGAAG  1002    -1      +       -1      -1      00000000000000000000000 1       0       0       GAAAACGGCTCCCACTTATTCTACACCTCTCAAGTCATTTCACAAAGTCGGACTAGAGTCAAGCTCAACAGGGTCTTCTTTCCCCGCTGATTCTGCCAAGCCCGTTCCCTTGGCTGTGGTTTCGCTAGATAGTAGATAGGGACAGTGGGAA FFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFF:FFFFFFF .       .       .       .       1,0,14943298,14943448,0,00,10,11843,11823,15526,118231,0,14943298,14943448,0,00,10,11843,11823,15526,11823      1,0,15184887,15185037,0,00,11,11685,11645,11646,116451,0,15184887,15185037,0,00,11,11685,11645,11646,11645
        at align2.AbstractMapThread.rescue(AbstractMapThread.java:1200)
        at align2.BBMapThread.processReadPair(BBMapThread.java:1097)
        at align2.AbstractMapThread.run(AbstractMapThread.java:536)
Exception in thread "Thread-14" java.lang.AssertionError: A00605:23:HHNVHDSXX:1:1101:2293:1016 2:N:0:TAATGCGC+AGGCGAAG  1404    -1      +       -1      -1      00000000001000000000000 1       0       0       NATAGAGACAAGCTTTTATAGATAGAGAGGAAAGAGATAGGATCAACCACAATATTCATGGGATTGGCTTTATCACTTAGAAACTTCCATGAAAGGTGGCAAACCACTTCCCTTCTATGGAGATTCG !FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFF .       .       .       .       1,0,37647506,37647634,0,00,6,7881,8211,0,82111,0,37647506,37647634,0,00,6,7881,8211,0,8211
        at align2.AbstractMapThread.rescue(AbstractMapThread.java:1200)
        at align2.BBMapThread.processReadPair(BBMapThread.java:1090)
        at align2.AbstractMapThread.run(AbstractMapThread.java:536)
Exception in thread "Thread-8" java.lang.AssertionError: A00605:23:HHNVHDSXX:1:1101:3766:2785 2:N:0:TAATGCGC+AGGCGAAG   3802    -1      +       -1      -1      00000000001000000000000 1       0       0       GCAATGGATCGGTAGCATTACCCCAAATATGGATGGTATGGAGAGACCATGGTG  FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFF  .       .       .       .       1,0,21465899,21466010,0,00,1,1003,0,0,01,0,21465899,21466010,0,00,1,1003,0,0,0  1,0,27814628,27814681,0,00,4,4856,4856,4857,48561,0,27814628,27814681,0,00,4,4856,4856,4857,4856
        at align2.AbstractMapThread.rescue(AbstractMapThread.java:1200)


-------------------
---------------------
-----------------------------


, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19

**************************************************************************
Warning!  20 mapping threads did not terminate normally.
Check the error log; the output may be corrupt or incomplete.
Please submit the full stderr output as a bug report, not just this message.
**************************************************************************


   ------------------   Results   ------------------

Genome:                 1
Key Length:             13
Max Indel:              16000
Minimum Score Ratio:    0.56
Mapping Mode:           normal
Reads Used:             212     (28878 bases)

Mapping:                0.669 seconds.
Reads/sec:              316.77
kBases/sec:             43.15


Pairing data:           pct pairs       num pairs       pct bases          num bases

mated pairs:              2.8302%               3         1.9600%                566
bad pairs:                0.0000%               0         0.0000%                  0
insert size avg:           97.67


Read 1 data:            pct reads       num reads       pct bases          num bases

mapped:                   2.8302%               3         1.9552%                283
unambiguous:              2.8302%               3         1.9552%                283
ambiguous:                0.0000%               0         0.0000%                  0
low-Q discards:           0.9434%               1         1.0432%                151

perfect best site:        0.0000%               0         0.0000%                  0
semiperfect site:         0.0000%               0         0.0000%                  0
rescued:                  0.0000%               0

Match Rate:                   NA               NA        86.9258%                246
Error Rate:             100.0000%               3         9.1873%                 26
Sub Rate:               100.0000%               3         9.1873%                 26
Del Rate:                 0.0000%               0         0.0000%                  0
Ins Rate:                 0.0000%               0         0.0000%                  0
N Rate:                  33.3333%               1         3.8869%                 11


Read 2 data:            pct reads       num reads       pct bases          num bases

mapped:                   2.8302%               3         1.9647%                283
unambiguous:              2.8302%               3         1.9647%                283
ambiguous:                0.0000%               0         0.0000%                  0
low-Q discards:           1.8868%               2         1.8189%                262

perfect best site:        0.0000%               0         0.0000%                  0
semiperfect site:         0.0000%               0         0.0000%                  0
rescued:                  0.0000%               0

Match Rate:                   NA               NA        89.0459%                252
Error Rate:             100.0000%               3         9.5406%                 27
Sub Rate:               100.0000%               3         9.5406%                 27
Del Rate:                 0.0000%               0         0.0000%                  0
Ins Rate:                 0.0000%               0         0.0000%                  0
N Rate:                  33.3333%               1         1.4134%                  4
Exception in thread "main" java.lang.AssertionError:
The number of reads out does not add up to the number of reads in.
This may indicate that a mapping thread crashed.
If you submit a bug report, include the entire console output, not just this error message.
3+0+0+82+1+0 = 86 != 106
        at align2.AbstractMapper.printOutputStats(AbstractMapper.java:1961)
        at align2.AbstractMapper.printOutput(AbstractMapper.java:1059)
        at align2.BBMap.testSpeed(BBMap.java:522)
        at align2.BBMap.main(BBMap.java:35)
job finishing at 09:42:59

Last edited by abubd; 10-25-2021 at 01:54 AM.
abubd is offline   Reply With Quote