View Single Post
Old 06-06-2017, 08:23 AM   #230
jweger1988
Member
 
Location: Paris, France

Join Date: Apr 2017
Posts: 37
Default

Hi Brian,

I'm trying to do some trimming of primer sequences from amplicons that I sequenced.

I have a viral genome that was amplified in 5 large-ish overlapping pieces (~2-3kb) and then fragmented and sequenced on a nextseq (1x150 SE).

I would like to trim only the primer sequences on the end of the read. The problem is I have primers of all different lengths, how would you go about encompassing all of the primers in one round of bbduk trimming? Or would you have to do them individually for each k value?

I was thinking something like this
Code:
bbduk.sh in=$f1 out=${file_base}_ff.fq.gz literal=AGTTGTTAGTCTACGTGGA,AGCTGGAAAAACAAAGAACT,GCCAAGAAACAGGATGTCGTTG,GCCGTAATTGGTATCGATACTGGA,GGACATGGGCAGATTGAC,ACTGTGAGGATGGCTATGA,GCAGACAGAAAGTGGTGTTTT,ACAAAACGTGGGCTTACCATG,AGGCCTAACAAAAGGAGGAC,TTTCCCAGCGTCAATATGCT ktrim=l k=24 mink=15 hdist=2 qtrim=rl trimq=30 restrictleft
Where the mink=15 encompasses all of the primer shorter than the longest (k=24). Does this seem OK?

Thanks in advance.

Last edited by GenoMax; 06-06-2017 at 08:46 AM. Reason: Added [CODE] tags
jweger1988 is offline   Reply With Quote