View Single Post
Old 10-05-2015, 03:05 AM   #1
JBKri
Member
 
Location: Heraklion, Greece

Join Date: Jan 2014
Posts: 79
Default Doing PCR enrichment on PCR-free TruSeq lib?

I am making a contingency plan in case our next TruSeq (DNA) PCR-free libraries don't have sufficient yield. As far as I can tell the only difference between TruSeq PCR-free and TruSeq Nano is the DNA input amount and the lack of PCR enrichment at the end of the PCR-free protocol. So if we end up with too low yield it should be possible to do some PCR-cycles with the primers here: http://bioinformatics.cvr.ac.uk/blog...mer-sequences/ :
PCR Primer 1.0 (P5)
5 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGA 3
and
PCR Primer 2.0 (P7)
5 CAAGCAGAAGACGGCATACGAGAT 3

Further, I was thinking we probably have these primers in leftovers from another kit, in the "PCR Primer Cocktail" from a TruSeq stranded mRNA kit. Can anyone confirm this? From the same kit we have only a small amount of PCR Master Mix, so we are thinking to use KAPA HiFi mix instead. Does anyone have an idea of the annealing temperature to use?
JBKri is offline   Reply With Quote