View Single Post
Old 02-06-2013, 11:47 PM   #5
thedamian
Member
 
Location: Barcelona

Join Date: Feb 2012
Posts: 49
Default

ok, real example:
I have gene IL10, NM_000572.2.
Based on NM_000572 from UCSC I get:

name: NM_000572
chrom: chr1
strand: -
txStart: 206940947
txEnd: 206945839
cdsStart: 206941980
cdsEnd: 206945780
exonStarts: 206940947,206943173,206944251,206944700,206945615,
exonEnds: 206942073,206943239,206944404,206944760,206945839,
name2: IL10

so first CDS is from 206941980 to 206942073

then I use:
Code:
samtools faidx hg19.fa chr1:206941978-206942075
( I added +2 to each side because UCSC is 0-based, hg19 1-based)
the output:
GTCTCAGTTTCGTATCTTCATTGTCATGTAGGCTTCTATGTAGTTGATGAAGATGTCAAACTCACTCATGGCTTTGTAGATGCCTTTCTCTTGGAGCT

no ATG, and TAC in here;/
thedamian is offline   Reply With Quote