View Single Post
Old 07-23-2010, 11:23 PM   #9
nilshomer
Nils Homer
 
nilshomer's Avatar
 
Location: Boston, MA, USA

Join Date: Nov 2008
Posts: 1,285
Default

Quote:
Originally Posted by Naujv View Post
nils thanks for the help! i'm new (as in today new) to bwa. it may not be an error/bug, though i tried to look where the alignment is, i couldn't find it. the sequence looks like one big ugly repeat, so maybe this is spurrious. maybe you can help me understand what 40 in the line is? mapping quality? where does good and bad lie?

GKTESVC03GKDWH 16 ref|NG_023054.1|:5000-113024 77792 40 46S48M143S * 0 0 ATTCCATTCCATTCCATTCGGTTTNAACGGTATTCCAATCGATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCTTTCCATTCCATTACGGATGATTCCATTCCATTGCATTCCATTCCATTCCATTCCCCTGTACTCGGGTTGATTCCATTCCATTCCATTCCAATCCATGCCATTCCACTCGTGTTGATTCCATTCTTTCCATTCCATTCAAGTTGATTCCATTCCAT .199;:992131111:.,.--,,,!--.--17995566999:=BBABBBBBDDDAAA????DAAAAADBBBAA>=<900000..22:;9;;<62444444<<==>=>>>>>AB===A?????DDDDFFDDFFFF;;99<??@@<<44488ABBBBDDDFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFHFDCCCFFFF888CCGFFFFGDFFFFC??@A????FCCDDHF
AS:i:44 XS:i:0 XF:i:2 XE:i:6 XN:i:0
Have a real close read of the SAM specification. You will be going back to this quite a bit. The 5th column is the PHRED-scaled mapping quality. Looking at the CIGAR field (6th column), "46S48M143S", there seems to be 48 bases matching your reference, with the first 46 and last 143 soft-clipped.
nilshomer is offline   Reply With Quote