View Single Post
Old 03-28-2016, 06:38 PM   #1
Junior Member
Location: SZ

Join Date: Mar 2016
Posts: 7
Default Three reads with the same name in the BAM file

Hi all,

I am dealing with the paired-end BAM file, and come up with many warnings like this:

WARNING: Could not find pair for HWI-ST430:177:2:1:4979:15503#0
WARNING: Could not find pair for HWI-ST430:177:2:1:5127:13427#0
WARNING: Could not find pair for HWI-ST430:177:2:1:6521:21452#0
I check the warning reads in the BAM file, and find all the warning reads have three reads with the same name. For example:

HWI-ST430:177:2:1:4979:15503#0	401	chr32	26100739	60	36M64H	=	26100696	-79	GCCTAAAATTTACAAAAACAATAATAAAAACAACAG	===<=>>=>>===>===<=>===========>;===	SA:Z:chr5,36697147,+,72M28S,60,2;	BD:Z:IHHE??FF?EGEF???FEFFFDFGE@@AHHIJFIFF	MD:Z:36	PG:Z:MarkDuplicates	RG:Z:Basenji	BI:Z:HGHGBBFFAEGFFAAAEFFEGFEGFABBFGHGGHFF	NM:i:0	AS:i:36	XS:i:22
The BAM file is alignment of HiSeq reads aligned to the reference genome using bwa, and use picard to remove redundancy. Base realignments were done using gatk.

My confusion is:
1、Why there are three reads with the same name, but have no relation?
2、Maybe the first two are treated as mate pairs and the third as a single read. So could I just ignore it?

Could eveyone help me? Many thanks for your help!
Alphabets is offline   Reply With Quote