View Single Post
Old 10-17-2014, 01:43 AM   #1
JadeB
Junior Member
 
Location: Toulouse, France

Join Date: Oct 2014
Posts: 5
Default GSNAP and SAM header

Dear all,

I'm currently trying to align reads on a reference sequence with gsnap with this code :

Quote:
gsnap --gunzip -D ./ref/cristata -d cristata ./data/cristata/Pig-GC01_AGTTCC_L005_R1.fastq.gz ./data/cristata/Pig-GC01_AGTTCC_L005_R2.fastq.gz -t 8 -B 4 -A sam --nofails --clip-overlap --split-output GC01
I'm working with very short reads, it's why i'm using the clip-overlap command.

Work is finishing without error message, but my sam header is not complete, so I can't use my results files.

For example :

Quote:
head ./GC01.concordant_uniq

@SQ SN:GC01-(1934) LN:17090
HWI-ST314:2581WBYACXX:5:1101:3036:2447 99 GC01-(1934) 11568 40 58M42H = 11626 116 GACCCTTCCTACCCACATCACGTCCATCCAAAATTCAACCACACGAGAGCACCTCCTT CCCFFFFFHHHHHJJJJJJIJJHIIIGJJJJJIJJJJJJJIJJJGJJJJJJJJJJJIJ MD:Z:58 NH:i:1 HI:i:1 NM:i:0 SM:i:40 XQ:i:40 X2:i:0
[...]
I only have the @SQ line, and no @HD line in the header.

Do you see something I missed ?

Thanks a lot in advance for your help !!

Jade
JadeB is offline   Reply With Quote