View Single Post
Old 10-09-2012, 10:08 AM   #1
rahilsethi
Member
 
Location: Pittsburgh, PA

Join Date: May 2010
Posts: 22
Unhappy SHRiMP 2 output problem

Hi,

I used SHRiMP 2.2.2 for mapping (gapped mapping) SOLiD Paired End data to hg19 genome reference. The SAM output file does not have any value at QV column, instead has "*" as a placeholder. For example:

271_822_1591_F 163 chrM 1 255 35M = 146 194 GATCACAGGTCTATCACCCTATTAACCACTCACGG * AS:i:310 NM:i:0 CS:Z:T12321112012233211002330301311222130 CM:i:2 XX:Z:GATCACAGGTCTATCACCCTATTAACcACTCaCGG
86_1077_1408_F 163 chrM 1 255 3H32M = 126 175 GATCACAGGTCTATCACCCTATTAACCACTCA * AS:i:320 NM:i:0 CS:Z:T33102321112012233211002330301011221 CM:i:0 XX:Z:GATCACAGGTCTATCACCCTATTAACCACTCA

I understand this because SHRiMP 2 never asks for .qual filename/s when put on run. Now almost all the variant calling algorithms such as SNVer, VarScan, GATK etc. require base/color quality values for evaluation of their variant call and end up giving error. Even the mpileup/bcftools seem to be giving abnormal results with almost all of the variant calls as In-Dels. Is there anyway I can make SHRiMP2 give out value to QV column in output so that I can run the variant calling tools on it?

My SHRiMP 2.2.2 run was:

gmapper-cs \
--max-alignments 800 \
-N 12 \
--pair-mode opp-in \
--isize 0,250 \
--all-contigs \
--single-best-mapping \
--local \
--sam \
-1 trimmed_read_F3_50bp.csfasta -2 read_F5.csfasta \
hg19.ucsc.fa > output_trimmed_50bp.sam 2> output_trimmed_50bp.log

Thanks in advance
rahilsethi is offline   Reply With Quote