View Single Post
Old 05-05-2016, 12:18 PM   #60
lcmb
Junior Member
 
Location: Bethesda, MD

Join Date: May 2015
Posts: 6
Default Truncated merges

Hello,

I have noticed that some of my merged sequences, after using BBMerge, are truncated. My R1/R2 input sequences are 251 bp long (paired-end 250 bp sequencing). The overlap/insert, which I expect to be merged from the R1/R2 files, is 202 bp long. Although many of my merged sequences are the expected 202 bp long, a handful are much shorter.

The only optional parameter I have changed is setting mismatches=0, as I do not want any discrepancies in the overlap.

Here is an example:
Code:
Raw Data: R1 and R2 files (fastq.gz)
R1 File: 251 nucleotides
@M02344:9008:000000000-AJ1PF:1:1110:28244:16073 1:N:0:TGACCAAT+ATAGAGGC
TCTGCCGTCATCGACTTCGAAGGTTCGAATCCTTCCCCTCTAACCACGGCCGAAATTCAATACCCGGATCAAGCTCAATTCGGGTCGAGGTCGGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATGTCGTATGCCGTCTTCTGCTTGAAAAAAAATAAGTGGTGCGAAGAGAGCCTGTGGCCAACCTCATATGCGTGGAGATGTCTCG

R2: 251 nucleotides
@M02344:9008:000000000-AJ1PF:1:1110:28244:16073 2:N:0:TGACCAAT+ATAGAGGC
CGGAGCCTATGGAAAAACGCCAGCAACGCGGCCCGACCTCGACCCGAATTGAGCTTGATCCGGGTATTGAATTTCGGCCGTGGTTAGAGGGGAAGGATTCGAACCTTCGAAGTCGATGACGGCAGAAGATCGGAAGAGCGTCGTGTAGGGAAGGAGTGGGCCTAGATGTGTGGGTCGCGGTGGTGGCCGGATCGATGAAGAAAGTCTGGTGCTGGTGTGTGTGACGCCAGGGCGTCAGCAGTGGTGATGTG

------------------------------------------------------------------------------------------------------------------------------------------------------

BBMerge Output: 126 nucleotides
@M02344:9008:000000000-AJ1PF:1:1110:28244:16073 1:N:0:TGACCAAT+ATAGAGGC
TCTGCCGTCATCGACTTCGAAGGTTCGAATCCTTCCCCTCTAACCACGGCCGAAATTCAATACCCGGATCAAGCTCAATTCGGGTCGAGGTCGGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCG

------------------------------------------------------------------------------------------------------------------------------------------------------
Thank you for your help!
lcmb is offline   Reply With Quote