View Single Post
Old 12-27-2009, 07:23 AM   #1
arthur.yxt
Member
 
Location: Berlin

Join Date: Oct 2009
Posts: 10
Default Bowie12Beta mapping direction restriction or bug?

Dear all, I was trying to map 76nt reads using Bowtie. I wanted to use the "seed" feature to avoid trimming off the adapter sequence.

1) this is the sequence that I trimmed off the last "4nt" long "adapter", which is not really the adapter, and I got it mapped.
HWUSI-EAS1621.1.2.1.5.745.0 16 chr1 173833971 255 72M * 0 0 CATCAGATAGGAGCGAAAGACTTAATATTGCTCATCAGCGTTAGTCTGCTGAACTATGTTATCATCATTGTA ;:;143>>=9:>:+=A?B78A?BBAB@@@=B<AA@B@;?0>BA8>A@7@ABB<BBBABBAA?:?BACCBABB XA:i:0 MD:Z:72 NM:i:0

2) so now I map the non-trimmed 76nt sequence, it turned out unmapped.
HWUSI-EAS1621.1.2.1.5.745.0 4 * 0 0 * * 0 0 TACAATGATGATAACATAGTTCAGCAGACTAACGCTGATGAGCAATATTAAGTCTTTCGCTCCTATCTGATGATCT BBABCCAB?:?AABBABBB<BBA@7@A>8AB>0?;@B@AA<B=@@@BABB?A87B?A=+:>:9=>>341;:;<919 XM:i:0

my parameters: -q -n 3 -l 30 -k 10 --solexa1.3-quals --best -S -y
So here is the thing: the seed length is 30nt, and is a perfect match(on reverse strand), so it ought to be reported. But why not?

Thanks in advance!
arthur.yxt is offline   Reply With Quote