View Single Post
Old 07-03-2011, 12:38 AM   #4
ETHANol
Senior Member
 
Location: Western Australia

Join Date: Feb 2010
Posts: 308
Default

Somebody must be making their own TruSeq PCR primers (PCR Primer Cocktail as Illumina calls it).

Anyway, after looking at the old and new adaptor sequences, I was going to give the following primers a try:

5' aatgatacggcgaccaccga*g
5' CAAGCAGAAGACGGCATACGA*G
*=phosphothiorylate bond

Seems like it should work. Anybody have any opinion?

Last edited by ETHANol; 07-03-2011 at 01:04 AM. Reason: edited to correct a typing error in the second primer sequence
ETHANol is offline   Reply With Quote