View Single Post
Old 01-26-2011, 01:09 AM   #1
michy
Junior Member
 
Location: oxford

Join Date: Aug 2008
Posts: 5
Default Bowtie and reads that failed to align: (100.00%)

Hello,
Can someone help me please. I have some new paired-end sequence from illumina and the reads are not aligning. What am I doing wrong? An example of the reads are below with the commandline I am using. I would be grateful for any help, cheers.

Read from sequence file #1
@HISEQ2000_0110:4:68:14837:199814#GGGCGG/1
GCTCCAGTATAGGGGAATGCCAGGACTAGGAAGAGGGATTGTGTGGTTTGGAGAGCAGGACGGAGGGAGGGTATACGTCACTATGAGATGGGAAACTTGTA
+HISEQ2000_0110:4:68:14837:199814#GGGCGG/1
ccccc_ca\c[[]X]JYJVRRHSXHMMNYVPVZEIWFFYXXZ_Z]cbccb_J[G_VPZUF^X`H`^YD`BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
@HISEQ2000_0110:4:68:14861:199831#GCACTG/1


Read from sequence file #2
@HISEQ2000_0110:4:68:14837:199814#GGGCGG/2
CACTTTAAAATCTATTTGATCTTGAGGAAATCAGTTGTGTTTCCTAGTTATATAGTCTATCATTTAATAATAGCACTAATGAAGTGTTTAGAAGTAATAAT
+HISEQ2000_0110:4:68:14837:199814#GGGCGG/2
ggggggggggfbfIffffefggggeggggeU^cf_eedfee^ZZ\accdd]eeeeffedfI[bbbcYccbeaeddgggaedTcc_dbfdIc\c\P_ZM_BB


Commandline
./bowtie -t -p 14 -q -I 0 -X 300 -S --chunkmbs 2048 mus -1 ../working/s_temp_1.txt -2 ../working/s_temp_2.txt ../working/s_temp_aligned.sam
michy is offline   Reply With Quote