Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • Giorgio C
    Member
    • Oct 2010
    • 89

    Blast > parsing result in Exel

    Hy everybody,

    in this situation froma blast (-m 1) result file :

    Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
    Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
    "Gapped BLAST and PSI-BLAST: a new generation of protein database search
    programs", Nucleic Acids Res. 25:3389-3402.

    Query= 132-291
    (59 letters)

    Database: Scrivania/orchidea/mature_mirBase.fa
    21,643 sequences; 470,608 total letters

    Searching..................................................done



    Score E
    Sequences producing significant alignments: (bits) Value

    mtr-miR2644b MIMAT0013413 Medicago truncatula miR2644b 28 0.031
    mtr-miR2644a MIMAT0013412 Medicago truncatula miR2644a 28 0.031
    gga-miR-1704 MIMAT0007596 Gallus gallus miR-1704 22 1.9
    gga-miR-1557 MIMAT0007414 Gallus gallus miR-1557 22 1.9
    mmu-miR-880-5p MIMAT0017266 Mus musculus miR-880-5p 22 1.9

    132_0 8 cagccgctcagattgatggtgcctacagccttgccagcccgctcagattgat 59
    12631 5 .............. 18
    12630 5 .............. 18
    7826 5 ........... 15
    7644 19 ........... 9
    5394 3 ........... 13
    5394 3 ........... 13
    BLASTN 2.2.21 [Jun-14-2009]


    Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
    ...
    ....
    ..........

    ______________________________________________________________
    I need to parse in an exel sheet :

    1)ID 2)Name of the hit 3)E-value 4)Score 5)Species


    1) 132-291 2)mir2644b 3) 0,031 4)28 5) Medicago truncatula


    Is possible from a big blast result file obtain an exel with 5 columns where every field is the first hit of the blast result. Can anyone halp me to fix this problem ??? Also with a little script in perl.


    Thank you very much
  • NicoBxl
    not just another member
    • Aug 2010
    • 264

    #2
    use -m 8 for tabular output and then import in excel

    Comment

    • Giorgio C
      Member
      • Oct 2010
      • 89

      #3
      I know the -m 8 view but give me another result respect to m1 with lack of information. So i ask you a little script to handle the txt file and parse it on exel.

      Comment

      • maubp
        Peter (Biopython etc)
        • Jul 2009
        • 1544

        #4
        You really don't want to try and use Excel for parsing plain text BLAST output. Parsing plain text BLAST output is annoying enough in a proper language like Perl or Python - BioPerl, Biopython and the NCBI don't recommend it. Rather they recommend to use the tabular output (simpler) or the XML ouput (richer).

        Note BLAST+ lets you request quite a lot of extra columns of information in the tabular output. If that still isn't enough, I would write a script (not using Excel) to parse the extra information from the XML BLAST output.

        In fact, you really shouldn't want to use Excel for Bioinformatics in the first place. One very nicely documented reason is here http://dx.doi.org/10.1186/1471-2105-5-80
        Last edited by maubp; 11-15-2011, 04:57 AM. Reason: Note about BLAST+ extra columns in tabular output; recommendation

        Comment

        • Giorgio C
          Member
          • Oct 2010
          • 89

          #5
          Thanks you very much, i did not know about this limit, i'll read the paper.

          Cheers

          Comment

          • maubp
            Peter (Biopython etc)
            • Jul 2009
            • 1544

            #6
            I see you're opting for Perl, in which case using BioPerl to parse the BLAST text output is a very good idea: http://lists.open-bio.org/pipermail/...er/035872.html

            Comment

            • Giorgio C
              Member
              • Oct 2010
              • 89

              #7
              Yes, infact !!! Thanks you very much !!!

              Comment

              Latest Articles

              Collapse

              • mylaser
                Reply to Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                by mylaser
                Kheloyar – Everything You Need to Know About Kheloyaar Login and Kheoyar Id
                If you are looking for an online gaming platform that offers a user-friendly experience, Kheloyar has become a name that many users search for. Whether you're interested in creating a new account, accessing your dashboard through Kheloyaar Login, or learning how to obtain a Kheoyar Id, understanding the platform's features and account process is essential.
                This guide explains everything you need to know about...
                Today, 01:13 AM
              • SEQadmin2
                Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                by SEQadmin2



                Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                ...
                07-09-2026, 11:10 AM
              • SEQadmin2
                Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                by SEQadmin2



                Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                07-08-2026, 05:17 AM

              ad_right_rmr

              Collapse

              News

              Collapse

              Topics Statistics Last Post
              Started by SEQadmin2, 07-09-2026, 10:04 AM
              0 responses
              16 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 07-08-2026, 10:08 AM
              0 responses
              10 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 07-07-2026, 11:05 AM
              0 responses
              22 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 07-02-2026, 11:08 AM
              0 responses
              31 views
              0 reactions
              Last Post SEQadmin2  
              Working...