Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • apche93
    Junior Member
    • Feb 2012
    • 1

    s_#_sorted.txt to BED

    Hi all,

    I am trying to convert the following type of code into bed format or really anything that I can view in IGV or IGB browsers. I think it is in eland sorted format, but not too sure.

    Code:
    HWI-EAS240      FC2087UAAXX     3       257     951     322                     TGTTGTCTCTCTTCTGGGTCTAGCCACCTAGCAAGT    [[[[[[[[[[[[[[[ZZU[[[[U[[Z[[X[VSSOVS    chr10.fasta             53590   R       33G2    0

    I looked around and found that I might be able to use SAMTOOLS or FINDPEAKS. This is probably a simple conversion, but I'm not too familiar with the implementation of these programs so I'd really appreciate any help.

    Thanks in advance!

Latest Articles

Collapse

  • mylaser
    Reply to Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
    by mylaser
    Kheloyaar: The Complete Guide to Kheloyaar Loginand Kheloyaar ID
    The online gaming industry has transformed the way people enjoy digital entertainment. As technology continues to improve, players are looking for platforms that offer convenience, security, and a seamless user experience. Kheloyaarhas gained attention among users who value an easy-to-use platform, quick account access, and a simple registration process.
    Whether you're exploring Kheloyaar for the first time or want to understand...
    Today, 09:27 PM
  • SEQadmin2
    Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
    by SEQadmin2



    Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
    ...
    Today, 11:10 AM
  • SEQadmin2
    Cancer Drug Resistance: The Lingering Barrier to Rising Survival
    by SEQadmin2



    Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

    There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
    Yesterday, 05:17 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by SEQadmin2, Today, 10:04 AM
0 responses
8 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, Yesterday, 10:08 AM
0 responses
7 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-07-2026, 11:05 AM
0 responses
10 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-02-2026, 11:08 AM
0 responses
31 views
0 reactions
Last Post SEQadmin2  
Working...