Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • Vinz
    Member
    • Dec 2010
    • 80

    Dual indexing construct for MiSeq - where to put the barcode for index2?

    We would like to use the second indexing read on the MiSeq for amplicon sequencing (not using the Illumina Custom Amplicon Sequencing). Has anyone successfully designed the adaptors containing index2? Where would you put the barcodes?
    I assume "TrueSeq Universal Adapter" from the "Illumina-Customer-Sequence-Letter" would be the sequence to start.
    Thanks
    Vinz
  • koadman
    Member
    • May 2010
    • 65

    #2
    Hi Vinz, I looked into this and the information that Illumina distributes to customers does not contain the full length adapter sequences as far as I know. You might also be interested in this thread where csquared helpfully suggested that the 2nd barcode is inside the other adapter and is primed directly from the flowcell annealing sequence. Reading Illumina's instrument operation manuals appears to confirm this, they suggest there are some chemistry-only dark cycles prior to reading the other index in their standard protocol and these presumably synthesize the bases between the flow cell annealing region and the index region.

    However, if you are doing amplicon sequencing you probably have the flexibility to design your own sequencing primers in which case you might be able to follow a design like what Kircher et al have described. That would have the advantage of not wasting 9 cycles of reagents.

    Comment

    • Vinz
      Member
      • Dec 2010
      • 80

      #3
      Thanks for the link to the paper of Kircher et al. That is indeed helpful.
      The way the 2nd barcode is sequenced is nicely described in the Dual Indexing Training for all that have access. It just does not show any sequences.

      Comment

      • koadman
        Member
        • May 2010
        • 65

        #4
        The video in that training is the best explanation I've seen yet of the dual index adapter structure and sequencing process. Interesting that the 2nd index is sequenced while the template molecule is bridged. Thanks Vinz!

        Comment

        • ECO
          --Site Admin--
          • Oct 2007
          • 1360

          #5
          Hey guys. I'm in the process of making my own Truseq-esque double indexing adapters for MiSeq, and (as you've seen) Illumina will not be forthcoming with the sequences...so I had to figure it out for myself and will share it with you.

          I just sequenced a standard single-indexed TruSeq library with the Nextera/Amplicon protocol and the below describes my observations.
          It may not help with figuring out the nextera sequences but probably contains some information that will help.

          I'm just about to run libraries with my own homebrew double indexing design, will post when/if it turns out well.

          Attached Files

          Comment

          • ECO
            --Site Admin--
            • Oct 2007
            • 1360

            #6
            Oh and page 5 of this document has as nice diagram of the process, so far the chemistry has seemed the same on the MiSeq.
            Attached Files

            Comment

            • Vinz
              Member
              • Dec 2010
              • 80

              #7
              Meanwhile we figured out how to do the dual indexing.
              What you have colored green are the 7 bases that are cut with an restriction enzyme and later added again by the 7 dark cycles. We hypothesize the restriction enzyme is DpnI. Recognition site GATC, cutting after GA.
              This green sequence should be as it is on the left side of the index. After the index the ACAC is repeated as this matches the 5' end of read 1 sequencing primer and then you go on with the red part...
              This works very well for us on the MiSeq for dual indexing with the primers of the cartridge.

              Comment

              • gnomers
                Junior Member
                • Dec 2009
                • 4

                #8
                Originally posted by ECO View Post
                I'm just about to run libraries with my own homebrew double indexing design, will post when/if it turns out well.
                By "homebrew," do you mean that you were using custom Read 1, i7 index and Read 2 primers? I am contemplating this strategy for dual indexed amplicons in order to avoid sequencing the constant regions that anneal to the PCR template.

                Either way, how did it turn out?

                Comment

                • seq_yak
                  Junior Member
                  • Feb 2012
                  • 2

                  #9
                  MiSeq Dual-indexing

                  Originally posted by Vinz View Post
                  Meanwhile we figured out how to do the dual indexing.
                  What you have colored green are the 7 bases that are cut with an restriction enzyme and later added again by the 7 dark cycles. We hypothesize the restriction enzyme is DpnI. Recognition site GATC, cutting after GA.
                  This green sequence should be as it is on the left side of the index. After the index the ACAC is repeated as this matches the 5' end of read 1 sequencing primer and then you go on with the red part...
                  This works very well for us on the MiSeq for dual indexing with the primers of the cartridge.
                  I have a library design based on Kirchner et al. as well and I'm planning to run it on the MiSeq. So, did you have to tweak the sample sheet of the MiSeq or did you use the standard Nextera program? Maybe you could even share your sample sheet here?

                  Thanks,
                  seq_yak
                  Last edited by seq_yak; 06-19-2012, 07:24 AM. Reason: a lot of typos

                  Comment

                  • Vinz
                    Member
                    • Dec 2010
                    • 80

                    #10
                    I have attached a recent sample sheet example.
                    The sequence of index1 (I7) needs to be reverse complemented of what you ordered as primer. The sequence of index2 is just as the primer was synthesized.
                    However, this will use the index and read primers of the cartridge. If you want to add your own primers you need to add this information.
                    Attached Files

                    Comment

                    • TonyBrooks
                      Senior Member
                      • Jun 2009
                      • 303

                      #11
                      Does that mean that using the following primers you could create your own dual indexed amplicon library?

                      AATGATACGGCGACCACCGAGA{TCTACAC}[i5 index][custom fwd]
                      CAAGCAGAAGACGGCATACGAGAT[i7 index][custom rev]

                      Dark cycles in curly brackets{ }
                      Read 1 with custom fwd
                      Index i7 with reverse compliment of custom rev
                      Index i5 same as Illumina's
                      Read 2 with custom rev

                      We'd be very interested in this for potential 16s studies as could then feasibly multiplex 96, or even 384 samples in one MiSeq run.

                      Comment

                      • Vinz
                        Member
                        • Dec 2010
                        • 80

                        #12
                        I think this should do it.

                        Comment

                        • seq_yak
                          Junior Member
                          • Feb 2012
                          • 2

                          #13
                          Originally posted by Vinz View Post
                          I have attached a recent sample sheet example.
                          The sequence of index1 (I7) needs to be reverse complemented of what you ordered as primer. The sequence of index2 is just as the primer was synthesized.
                          However, this will use the index and read primers of the cartridge. If you want to add your own primers you need to add this information.
                          Hi Vinz,

                          thanks for the input. So, if I understood you right you're able to use the primers of the cartridge and the sample sheet you posted to sequence such a TruSeq-esque library (attached)?
                          Attached Files

                          Comment

                          • Vinz
                            Member
                            • Dec 2010
                            • 80

                            #14
                            Hi seq_yak,
                            yes, with the design you attached things should work well. You do not need to add additional primers and with the sample sheet MiSeq should give you nice sequences. Good luck!

                            Comment

                            • pmiguel
                              Senior Member
                              • Aug 2008
                              • 2328

                              #15
                              Originally posted by Vinz View Post
                              Meanwhile we figured out how to do the dual indexing.
                              What you have colored green are the 7 bases that are cut with an restriction enzyme and later added again by the 7 dark cycles. We hypothesize the restriction enzyme is DpnI. Recognition site GATC, cutting after GA.
                              This green sequence should be as it is on the left side of the index. After the index the ACAC is repeated as this matches the 5' end of read 1 sequencing primer and then you go on with the red part...
                              So that would be a hemi-methylated DpnI site? With the flowcell oligo contributing the methylated adenine required for DpnI to cut?

                              --
                              Phillip

                              Comment

                              Latest Articles

                              Collapse

                              • SEQadmin2
                                Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                                by SEQadmin2



                                Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                                ...
                                Yesterday, 11:10 AM
                              • SEQadmin2
                                Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                                by SEQadmin2



                                Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                                There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                                07-08-2026, 05:17 AM
                              • GATTACAT
                                Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
                                by GATTACAT
                                Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
                                07-01-2026, 11:43 AM

                              ad_right_rmr

                              Collapse

                              News

                              Collapse

                              Topics Statistics Last Post
                              Started by SEQadmin2, Yesterday, 10:04 AM
                              0 responses
                              10 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-08-2026, 10:08 AM
                              0 responses
                              7 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-07-2026, 11:05 AM
                              0 responses
                              15 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-02-2026, 11:08 AM
                              0 responses
                              31 views
                              0 reactions
                              Last Post SEQadmin2  
                              Working...