Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • sehrrot
    Member
    • Jul 2010
    • 58

    Picard Error: IllegalArgumentException: Invalid fastq character:

    hi all

    I'm having trouble in using Picard to covert sam to bam. it seems to be halted by weird characters (I cannot type it here)

    Ignoring SAM validation error due to lenient parsing:
    Error parsing text SAM file. length(QUAL) != length(SEQ); Line 28
    Line: DFCDZDN1:130:B01D5ACXX:4:1101:1099:2046 99 chr3 134076497 60 100M = 134076563 166 AGGGCAGAGGAGGGGAGAGAATGGCTCAGAGTCCTGAAGCACCACCTCCTTCAGATCAGTATCTCCACCATGTCTGACAAGTCCTGGANTCTGGATGTAG $$$''''%)))))++*+((**+*+++++**+'))++**++**+**+(*)++++))))()'''''''%&%%$$"$&%$$$$%"$%$%% (weird character here)
    [Thu Feb 23 15:13:19 EST 2012] net.sf.picard.sam.SortSam done. Elapsed time: 0.00 minutes.
    Runtime.totalMemory()=123666432
    Exception in thread "main" java.lang.IllegalArgumentException: Invalid fastq character: (weird character here)
    at net.sf.samtools.SAMUtils.fastqToPhred(SAMUtils.java:408)
    at net.sf.samtools.SAMUtils.fastqToPhred(SAMUtils.java:387)
    at net.sf.samtools.SAMRecord.setBaseQualityString(SAMRecord.java:254)
    at net.sf.samtools.SAMTextReader$RecordIterator.parseLine(SAMTextReader.java:422)
    at net.sf.samtools.SAMTextReader$RecordIterator.next(SAMTextReader.java:278)
    at net.sf.samtools.SAMTextReader$RecordIterator.next(SAMTextReader.java:250)
    at net.sf.samtools.SAMFileReader$AssertableIterator.next(SAMFileReader.java:641)
    at net.sf.samtools.SAMFileReader$AssertableIterator.next(SAMFileReader.java:619)
    at net.sf.picard.sam.SortSam.doWork(SortSam.java:67)
    at net.sf.picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:177)
    at net.sf.picard.cmdline.CommandLineProgram.instanceMainWithExit(CommandLineProgram.java:119)
    at net.sf.picard.sam.SortSam.main(SortSam.java:79)
  • swbarnes2
    Senior Member
    • May 2008
    • 910

    #2
    Either the fastq was made wrongly, or the .sam was made wrongly. Those are not normal quality characters.
    Last edited by swbarnes2; 02-22-2012, 10:18 PM.

    Comment

    • maubp
      Peter (Biopython etc)
      • Jul 2009
      • 1544

      #3
      What is the weird characters? Try using hexdump.

      Comment

      • sehrrot
        Member
        • Jul 2010
        • 58

        #4
        Hi all

        now it's working fine after I removed "-I" from bwa alignment process ("bwa aln -t 4 -f input.sai -I hg19 input.fastq")

        Comment

        • maubp
          Peter (Biopython etc)
          • Jul 2009
          • 1544

          #5
          So you probably have Sanger style FASTQ, which is what the latest Illumina pipeline produces - but you told bwa it was the legacy Illumina specific FASTQ encoding.

          See:


          Comment

          Latest Articles

          Collapse

          • SEQadmin2
            Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
            by SEQadmin2



            Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
            ...
            Yesterday, 11:10 AM
          • SEQadmin2
            Cancer Drug Resistance: The Lingering Barrier to Rising Survival
            by SEQadmin2



            Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

            There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
            07-08-2026, 05:17 AM
          • GATTACAT
            Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
            by GATTACAT
            Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
            07-01-2026, 11:43 AM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by SEQadmin2, Yesterday, 10:04 AM
          0 responses
          9 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-08-2026, 10:08 AM
          0 responses
          7 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-07-2026, 11:05 AM
          0 responses
          12 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-02-2026, 11:08 AM
          0 responses
          31 views
          0 reactions
          Last Post SEQadmin2  
          Working...