Issues generating sam file format in ssaha2?

[eni]

Hi
I'm trying to map transcriptome data on a refference genome and generate the output in SAM format. The problem: when I run it, says:

SSAHA2: Reading hashtable reference into memory.
SSAHA2: Hashtable size      : 0.001007 GB
SSAHA2: Number of sequences : 1
SSAHA2: K-mer length        : 13
SSAHA2: Skip step           : 3
SSAHA2: Max. sequence length: 755119
position_table - Query probably contains unusual characters!
: Success

and the sam file is empty.
What does this mean? and How can I fix this?

Thanks

P.D.: I'm running the 2.5 version.

[eni]

More data:
When I run using normal output, it stops while analizing reads like this:

@F35ERS101ARI6V
GTAATAATGATGATATTAGTAGTAGTAGTAGTAGTAGTAGTGCTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTGCGAGTAGTAGTAGCACTAATAGTAGAAGTAAAGGAAAAAGTAAAA
+
HIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHCCB;9---,,63,,,,

I don't know to much about fastq format, but comparing with reads that don't cause problems, the last line looks quite suspicious (related to de quality data, rigth).

And the line corresponding to that read in the .qual file that I used to build the .fastq file is:

>F35ERS101ARI6V
39 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 34 34 33 26 24 12 12 12 11 11 21 18 11 11 11 11

The script I used to generate the fastq file is this:

#!/usr/bin/perl -w
 
use strict;
 
use Bio::SeqIO;
use Bio::Seq::Quality;
 
use Getopt::Long;
 
die "pass a fasta and a fasta-quality file\n"
  unless @ARGV;
 
 
my ($seq_infile,$qual_infile)
  = (scalar @ARGV == 1) ?($ARGV[0], "$ARGV[0].qual") : @ARGV;
 
## Create input objects for both a seq (fasta) and qual file
 
my $in_seq_obj =
  Bio::SeqIO->new( -file   => $seq_infile,
		   -format => 'fasta',
		 );
 
my $in_qual_obj =
  Bio::SeqIO->new( -file   => $qual_infile,
		   -format => 'qual',
		 );
 
my $out_fastq_obj =
  Bio::SeqIO->new( -format => 'fastq'
		 );
 
while (1){
  ## create objects for both a seq and its associated qual
  my $seq_obj  = $in_seq_obj->next_seq || last;
  my $qual_obj = $in_qual_obj->next_seq;
 
  die "foo!\n"
    unless
      $seq_obj->id eq
	$qual_obj->id;
 
  ## Here we use seq and qual object methods feed info for new BSQ
  ## object.
  my $bsq_obj =
    Bio::Seq::Quality->
	new( -id   => $seq_obj->id,
	     -seq  => $seq_obj->seq,
	     -qual => $qual_obj->qual,
	   );
 
  ## and print it out.
  $out_fastq_obj->write_fastq($bsq_obj);
}

So, what's the problem: my reads? the bioperl script? both?
If it's the bioperl script, is there another format converter arround? because I don't want to discard reads if there is another way to fix this...HELP!!!

[jkbonfield]

The quality line in fastq looks fine - with maximum character of "I" indicating Q40, as the .qual file states.

I can't see anything obviously wrong with it. Maybe Ssaha2 thinks it doesn't look like a standard DNA sequence due to the almost complete lack of C, but that would be harsh.

[eni]

Thanks for the answer.
After I saw your post, I used the reads in fasta format and the program ran smoothly so it seems the sequences themselves are not the problem...

Another question: Does SSAHA2 consider quality data while calculating the alignments scores or anything that could alter the results? I ask this because if not, I colud use the results obtained with the reads in fasta format an put the quality data in the .sam file...