Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • vini
    Junior Member
    • Mar 2011
    • 2

    Remove adapter sequence

    Hi,

    I am a newbie in the field of RNA-Seq and i apologize if this query seems too trivial. I have Solid data in fasta format and i am supposed to remove the P2 adapter.

    The P2 adapter sequence is:
    5' ------- (-) AGAGAATGAGGAACCCGGGG CAGTT--- - 3'
    3' ------- (-) TCTCTTACTCCTTGGGCCCC GTC----- - 5'

    Does this mean that the
    5' ------(-) AGAGAATGAGGAACCCGGGG CAGTT--- -3' will be present at the 3'end of the reads while the
    3' ------- (-) TCTCTTACTCCTTGGGCCCC GTC----- - 5' would be present at the 5'end of the read?

    Thanks,
    vini
  • KevinLam
    Senior Member
    • Nov 2009
    • 204

    #2
    When you say fasta format did you mean you converted the solid raw data from csfasta to fasta?

    That's generally not advised as it may introduce errors into your reads if there's an upstream miscall on the cs base.
    http://kevin-gattaca.blogspot.com/

    Comment

    Latest Articles

    Collapse

    • SEQadmin2
      Cancer Drug Resistance: The Lingering Barrier to Rising Survival
      by SEQadmin2



      Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

      There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
      Today, 05:17 AM
    • GATTACAT
      Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
      by GATTACAT
      Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
      07-01-2026, 11:43 AM
    • SEQadmin2
      Nine Things a Sample Prep Scientist Thinks About Before Sequencing
      by SEQadmin2


      I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.

      Here are nine questions we think about, in roughly the order they matter, before...
      06-18-2026, 07:11 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by SEQadmin2, Today, 10:08 AM
    0 responses
    6 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, Yesterday, 11:05 AM
    0 responses
    8 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-02-2026, 11:08 AM
    0 responses
    31 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 06-30-2026, 05:37 AM
    0 responses
    28 views
    0 reactions
    Last Post SEQadmin2  
    Working...