Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • repinementer
    Member
    • Dec 2009
    • 80

    MACS-ChIP seq-Error

    Code:
    Traceback (most recent call last):
      File "/home/taoliu/bin/macs", line 273, in <module>
        main()
      File "/home/taoliu/bin/macs", line 71, in main
        options.bg_redundant = bg_r (treat,options.max_dup_tags) # average
      File "/home/taoliu/bin/macs", line 225, in bg_r
        return float(total_duplicates)/(total_tags)
    ZeroDivisionError: float division
    I used the foolwing command and got above error. Is any one know what this is?
    Code:
    $ macs --format ELAND -t CMM028_191_unique_hits.txt -c CMM027_027_unique_hits.txt --name=CM28 --gsize=2473000000 --tsize=35 --mfold=25 --diag --wig
  • Xi Wang
    Senior Member
    • Oct 2009
    • 317

    #2
    First of all, you should check your Eland format, make sure it follows the following description, which is copied from MACS manual: http://liulab.dfci.harvard.edu/MACS/00README.html


    If the format is ELAND, the file must be ELAND output file, each line MUST represents only ONE tag, with fields of:

    1. Sequence name (derived from file name and line number if format is not Fasta)
    2. Sequence
    3. Type of match: NM - no match found. QC - no matching done: QC failure (too many Ns basically). RM - no matching done: repeat masked (may be seen if repeatFile.txt was specified). U0 - Best match found was a unique exact match. U1 - Best match found was a unique 1-error match. U2 - Best match found was a unique 2-error match. R0 - Multiple exact matches found. R1 - Multiple 1-error matches found, no exact matches. R2 - Multiple 2-error matches found, no exact or 1-error matches.
    4. Number of exact matches found.
    5. Number of 1-error matches found.
    6. Number of 2-error matches found. Rest of fields are only seen if a unique best match was found (i.e. the match code in field 3 begins with "U").
    7. Genome file in which match was found.
    8. Position of match (bases in file are numbered starting at 1).
    9. Direction of match (F=forward strand, R=reverse).
    10. How N characters in read were interpreted: ("."=not applicable, "D"=deletion, "I"=insertion). Rest of fields are only seen in the case of a unique inexact match (i.e. the match code was U1 or U2).
    11. Position and type of first substitution error (e.g. 12A: base 12 was A, not whatever is was in read).
    12. Position and type of first substitution error, as above.
    Xi Wang

    Comment

    • repinementer
      Member
      • Dec 2009
      • 80

      #3
      Yep. Thanx

      Ya I found out my format is GERALD(-Illumina). Wasted almost 3 hours to convert GERALD to BED or ELAND. Still no result.

      Found a perl script but it's for Solexa and Peakfinder package (Unfortunately jar files are not working (May be some Java file installation problems in my PC)).

      Now writing my own script to modify the format......

      Comment

      • repinementer
        Member
        • Dec 2009
        • 80

        #4
        Could any one post GERALD format with simple text file and ELAND format with a simple text file.

        Thanx

        Comment

        • repinementer
          Member
          • Dec 2009
          • 80

          #5
          Is it GERALD format?

          Code:
          GERALD															
          1	2	3	4	5	6	7	8	9	10	11	12	13	14	15
          B2GA005	1	1	95	1341	615	0	1	TAGTAGAGGCCCCCAATGTGGTCCAAGATTCCCTA	ggggggggggggggggggggghggggegggggggg	chr1.fa		3000839	R	35	113
          B2GA005	1	1	79	902	907	0	1	GAAAGGGACCACTGTGGGATGGAAGTGGACGTGAG	gdgdggdgbggfggfggceffeY^e[ecVYc]`]`	chr1.fa		3001342	R	26T8	71
          B2GA005	1	1	47	804	221	0	1	TAGTGGGAACAAGCTGACAGCTCTGTGTTCTGCTT	ggggggggggggggggggggggggggggggggggg	chr1.fa		3001805	F	35	87
          If it is. COuld you please explain the values in columns referring to? so that I could convert into ELAND
          Last edited by repinementer; 02-09-2010, 01:45 AM.

          Comment

          • repinementer
            Member
            • Dec 2009
            • 80

            #6
            GERALD to BED..Script

            But still not sure with F and R definitions I gave..

            Code:
            repine@pc499 ~/MACS-1.3.7.1
            $ awk '$13 == "R" {print $11,"\t",$12+35,"\t",$12,"\t",$13,"\t",$1} $13 == "F" {print $11,"\t",$12,"\t",$12+35,"\t",$13,"\t",$1}' CMM027_027_unique_hits.txt |tr 'F' '+' |tr 'R' '-'|tr -d '.fa'

            Comment

            Latest Articles

            Collapse

            • GATTACAT
              Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
              by GATTACAT
              Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
              07-01-2026, 11:43 AM
            • SEQadmin2
              Nine Things a Sample Prep Scientist Thinks About Before Sequencing
              by SEQadmin2


              I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.

              Here are nine questions we think about, in roughly the order they matter, before...
              06-18-2026, 07:11 AM

            ad_right_rmr

            Collapse

            News

            Collapse

            Topics Statistics Last Post
            Started by SEQadmin2, Yesterday, 11:05 AM
            0 responses
            7 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 07-02-2026, 11:08 AM
            0 responses
            28 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 06-30-2026, 05:37 AM
            0 responses
            27 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 06-26-2026, 11:10 AM
            0 responses
            26 views
            0 reactions
            Last Post SEQadmin2  
            Working...