BLAST possibly returning different results

[Jona]

Hi to everyone,
this is my very first post and first of all I'd like to thanks Seqanswers for the possibility offered.

I've submitted the following sequence to BLASTN:
CTTGACAAGCTAGCTTTAGTTTAAAAACTCCAACTGCCAAAGGAATTAAATTTTTCTTAAAGTAGTATTTCTAAAATACAATTTTTTTGAATTAGTAGTA

among the results I received also a single match to the following organism:
Clostridium botulinum Ba4 str. 657 GenBank CP001083.1

so I tried and run BLASTN again specifying the organism in the Organism field of BLASTN.

Surprisingly I did obtain 4 matches now (apart from plasmid). They are highlighted in black as poor results but why did BLASTN provide them now only?

Thanks for any help