Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • jmwhitha
    Senior Member
    • Mar 2013
    • 107

    BWA gives no alignment lines in SAM file

    Good morning,

    I am trying to map simulated reads generated from GemSIM to an index generated from a multi-fasta of the CLJU (bacteria) coding sequence from NCBI. I used these two commands and discovered there were no alignment lines in the SAM file, only header lines. Commands head and tail only returned lines starting with @, and grep -vnm1 '^@' returned nothing.

    bwa-0.7.3a/bwa index -a is -p CLJU ./CLJUcoding.fasta

    bwa-0.7.3a/bwa mem CLJU CLJUsimreadsCodeTrial.single.fastq > CLJUsimreadsCodeTrial.single.sam

    Any suggestions?

    Thanks and God bless,
    Jason
  • mastal
    Senior Member
    • Mar 2009
    • 666

    #2
    BWA gives no alignment lines in SAM file

    Did you get any error messages or other output when you ran BWA?

    I think your syntax is not quite right, according to the bwa manual page


    it should be
    bwa-0.7.3a/bwa mem ./CLJUcoding.fasta CLJUsimreadsCodeTrial.single.fastq > CLJUsimreadsCodeTrial.single.sam

    Comment

    • jmwhitha
      Senior Member
      • Mar 2013
      • 107

      #3
      Hello mastel,

      I did not get any error messages. In addition to my CLJUsimreadsCodeTrial_single.sam, I got a CLJU.amb, CLJU.ann, CLJU.bwt, CLJU.pac, and CLJU.sa. My CLJU.amb contains just one problem character according to head command ("3909174 4184 0"). The ann file looks like it contains appropriate text, and the rest of the files are not human readable.

      Tried your syntax suggestion and got back: "[E::bwa_idx_load] fail to locate the index files". This message did not occure when I used the syntax in the post above.

      Any other suggestions? Thank you very much.

      Comment

      • GenoMax
        Senior Member
        • Feb 2008
        • 7142

        #4
        Originally posted by jmwhitha View Post
        Hello mastel,

        My CLJU.amb contains just one problem character according to head command ("3909174 4184 0").
        What do you mean by "contains one problem character"?

        Are there spaces in identifier names in your genome reference file? How large is your reference file? What OS are you running this on?

        Can you post a few example lines from your sequence and reference files?

        Comment

        • jmwhitha
          Senior Member
          • Mar 2013
          • 107

          #5
          According to http://seqanswers.com/forums/showthread.php?t=20556, the .amb (ambiguous file) contains illegal characters. xied75 intentionally put an R and an S into his fasta file and got back two problem characters: 249240584 1 R and 249240585 1 S. The numbers I assume are coordinates of some sort, and my illegal character is "0".

          Yes there are spaces in the multi-fasta file I am using as a reference. According to "grep -c \ CLJUcoding.fasta" there are "4184".

          Genome Reference File
          "stat -c %s CLJUcoding.fasta" gives "4609956" (bytes) for the file size.
          Grabbing a sample from the head using "head -n30 CLJUcoding.fasta" I get:
          >lcl|NC_014328.1_cdsid_YP_003778217.1 [gene=dnaA] [protein=chromosomal replication initiator protein] [protein_id=YP_003778217.1] [location=101..1453]
          ATGAATGCCCATCCAAAAGAAATATGGGAACAATCTTTAAACATAATAAATGGTGAAATTACTGAAGTAAGCTTTAACACATGGATTAAAAGTATTACTCCTGTATCTATTGAAAATGACACCTTCATATTAAGTGTACCAAATGACCTTACCAAAGGCATATTAACTAGTAAATATAAAAATTTAATAGCTAATGCTCTAAAATTAATTACTTCAAAAAAATACAACATTAAATTTTTAATTGCCTCTGAATCAGAAGAAGCTTTAACATTAGACAATACTAATAAAAGACACAATAAAAATTCCGTATTGGTAAATGATGAAATGTCAACCATGCTAAATCCAAAATATACTTTTGATTCCTTCGTTATAGGTAATAGTAATAGATTCGCTCATGCAGCTTCACTTGCTGTAGCTGAATCACCTTCAAAAGCATATAATCCCCTATTCATATACGGAGGCGTAGGACTAGGCAAAACTCATTTAATGCATGCTATAGGACACTACATATTAAACAATAATAGTAAATCTAAAGTAGTATACGTTTCATCTGAAAAATTTACAAACGAACTTATAAATTCAATAAAAGATGATAAAAATGTAGAATTCAGAAATAAATATAGAAATATAGATGTACTCTTAATAGATGATATACAATTTATTGCAGGTAAAGAAAGAACCCAAGAGGAATTTTTTCATACCTTTAATGCATTATACGAGGCTAATAAACAAATAATTCTATCTAGTGATAGACCACCAAAAGAAATCCCTACATTAGAAGATAGACTTAGATCTAGGTTTGAATGGGGACTTATAGCAGACATTCAACCACCAGACTTTGAAACTAGAATGGCTATATTAAAAAAGAAGGCAGACGTCGAAAATTTAAATATTCCTAATGAAGTAATGGTGTATATAGCTACTAAAATTAAATCCAACATTAGAGAACTTGAAGGTGCGCTAATAAGAATAGTCGCTTTCTCCTCACTTACAAATAAAGAAATAAGTATAGATTTGGCAGTAGAAGCTTTAAAAGATATAATTTCAAGCAAACAATCAAAACAAGTTACTATAGACTTAATACAAGATGTAGTTGCCAACTATTATAACTTAAAAGTAGATGATTTAAAATCTGCAAGAAGAACAAGAAATGTAGCTTTTCCAAGGCAAATAGCTATGTACTTGTGTAGAAAACTTACAGATATGTCTTTGCCAAAAATCGGAGAAGAATTTGGCGGAAGAGATCATACTACCGTAATACATGCTTATGAAAAAATATCAACTAATTTAAAACAAGATGAAAGTCTTCAAAATGCTATAGGCGATTTAACAAAACGACTAAATCAAAATTAA
          >lcl|NC_014328.1_cdsid_YP_003778218.1 [gene=dnaN] [protein=DNA polymerase III subunit beta] [protein_id=YP_003778218.1] [location=1710..2813]
          ATGAACTTTATATGTACAAAAACAGAATTACAAGAAGCTATTTCAATAGCACAAAAAGCTATCACAGGGAAATCCAGCATGCCAATATTAAATGGTCTACTTATTACAACCTGTAAAAACCAAATTAAATTAACTGGATCAGATATAGACCTCAGTATAGAAACAAAAATAAATGCAGAAATAAAAGAAGAGGGATCCGTAGTAGTTGATTCTAGACTATTTGGAGAAATTATAAGAAAATTACCTAATGACAATATAAATATTTCTACTACAGAAAATAATTCAATAGAAATAATATGTCAAAAATCTAAATTTAATCTAATTCATATGAATGCAGAAGATTTTCCTGAAATACCTAATATAAATGAAAATATTATTTTCTTAATACCTCAAAAAATATTAAAAGATATGATAAAAAGTACTATTTTTGCTGCAGCTCAAGATGAAACTAGACCTATACTTACAGGAATTTTATTTGAAATCAAGGACAAAAAATTAAATTTAGTAGCATTAGACGGATATAGATTAGCTTTAAAATCAGAATATCTTAATACAGAAAA

          And for my fastq sequence (just first 10 lines):
          jmwhitha@Linux-OptiPlex-755:~$ head CLJUsimreadsCodeTrial_single.fastq
          @r1_from_gi|300853232|ref|NC_014328.1| Clostridium ljungdah_#0/1
          GACTCCTTGCAGCTGGGGAGGTAGAATACCCGATTATTATATTAGTCTAAAAATTGATAATGGTAAGCATTTGTTTTTAATAAATGAATTTCATAATGGG
          +
          IIIIGDIHIIIIDIIIIHIIIIDIHIIIIEIDFBIIF>HIIEEIIIIIFDEHEGH(IHF#IIHG#@HDGG@BGGBHGHBGD<HBBHIH@D>=BBGG@E>B
          @r2_from_gi|300853232|ref|NC_014328.1| Clostridium ljungdah_#0/1
          TATGGACTTGGTCTAATTTCATGTTGAACTTTATATTCCAGGACTTATTGGTTTCCACATCATTTCCTATAGTAATTCCGCTGTAATTAATTGCATGTAC
          +
          IDIIIIIIGIHHIIGIGIIIGIIIIIGIIIGDIIIHII@IIIICIIIGI=FIGIIGIGIBEIGHHHIHIE2GHHGHHHH?HIHGB=GIB?#6H>>EG@EC
          @r3_from_gi|300853232|ref|NC_014328.1| Clostridium ljungdah_#0/1
          TAATGGAAAAAAACTACTTATAGATTGTGGTGAGGGAACTCAAGTTAGCTTAAAAATACTTGGATGTAAAATAAAAAATATAGATGTAATTTTATTTACA

          Sorry, can't help the line wrapping.

          What do you think?

          Thank you again respondents.

          Comment

          • jmwhitha
            Senior Member
            • Mar 2013
            • 107

            #6
            Or actually, lack of wrapping.

            Comment

            • GenoMax
              Senior Member
              • Feb 2008
              • 7142

              #7
              I was able to generate a sam file (attached) using the test sequences you had included in previous post.

              Is the bwa you are trying to use known to work correctly? Did you download and compile it yourself?
              Attached Files

              Comment

              • jmwhitha
                Senior Member
                • Mar 2013
                • 107

                #8
                Oh, great!

                Yes, I downloaded and compiled it, but had some issues. See http://seqanswers.com/forums/showthread.php?t=29498

                What version of bwa are you using? I am using 0.7.3a

                Thank you so much!

                Comment

                • GenoMax
                  Senior Member
                  • Feb 2008
                  • 7142

                  #9
                  Originally posted by jmwhitha View Post
                  Oh, great!

                  Yes, I downloaded and compiled it, but had some issues. See http://seqanswers.com/forums/showthread.php?t=29498

                  What version of bwa are you using? I am using 0.7.3a

                  Thank you so much!
                  I did use 0.7.3a.

                  I think there is something wrong with your copy of bwa. You are not going to go far until that is fixed.

                  I assume you are the "sys admin" for this machine (since it appears to be a desktop). What flavor of linux are you running (is it running natively or as a virtual machine)?

                  I just noticed that there is bwa v. 0.7.4. out. Give that a shot to see if you fare better with the compilation.

                  Comment

                  • jmwhitha
                    Senior Member
                    • Mar 2013
                    • 107

                    #10
                    I used the following command to get the newest version of bwa from sourceforge:
                    wget http://sourceforge.net/projects/bio-...d?source=files -O bwa.tar.bz2

                    Then I opened the tarball and went into the directory with:
                    tar -xjf bwa.tar.bz2
                    cd bwa-0.7.4

                    This is what happens when I execute "make":

                    gcc -c -g -Wall -O2 -DHAVE_PTHREAD utils.c -o utils.o
                    gcc -c -g -Wall -O2 -DHAVE_PTHREAD kstring.c -o kstring.o
                    gcc -c -g -Wall -O2 -DHAVE_PTHREAD ksw.c -o ksw.o
                    In file included from ksw.c:28:0:
                    /usr/lib/gcc/i686-linux-gnu/4.7/include/emmintrin.h:32:3: error: #error "SSE2 instruction set not enabled"
                    ksw.c:44:2: error: unknown type name ‘__m128i’
                    ksw.c: In function ‘ksw_qinit’:
                    ksw.c:67:11: error: ‘__m128i’ undeclared (first use in this function)
                    ksw.c:67:11: note: each undeclared identifier is reported only once for each function it appears in
                    ksw.c:67:19: error: expected expression before ‘)’ token
                    ksw.c: In function ‘ksw_u8’:
                    ksw.c:110:2: error: unknown type name ‘__m128i’
                    ksw.c:126:2: warning: implicit declaration of function ‘_mm_set1_epi32’ [-Wimplicit-function-declaration]
                    ksw.c:127:2: warning: implicit declaration of function ‘_mm_set1_epi8’ [-Wimplicit-function-declaration]
                    ksw.c:133:3: warning: implicit declaration of function ‘_mm_store_si128’ [-Wimplicit-function-declaration]
                    ksw.c:140:3: error: unknown type name ‘__m128i’
                    ksw.c:141:3: warning: implicit declaration of function ‘_mm_load_si128’ [-Wimplicit-function-declaration]
                    ksw.c:142:3: warning: implicit declaration of function ‘_mm_slli_si128’ [-Wimplicit-function-declaration]
                    ksw.c:150:4: warning: implicit declaration of function ‘_mm_adds_epu8’ [-Wimplicit-function-declaration]
                    ksw.c:151:4: warning: implicit declaration of function ‘_mm_subs_epu8’ [-Wimplicit-function-declaration]
                    ksw.c:153:4: warning: implicit declaration of function ‘_mm_max_epu8’ [-Wimplicit-function-declaration]
                    ksw.c:177:5: warning: implicit declaration of function ‘_mm_movemask_epi8’ [-Wimplicit-function-declaration]
                    ksw.c:177:5: warning: implicit declaration of function ‘_mm_cmpeq_epi8’ [-Wimplicit-function-declaration]
                    ksw.c:183:3: warning: implicit declaration of function ‘_mm_srli_si128’ [-Wimplicit-function-declaration]
                    ksw.c:183:3: warning: implicit declaration of function ‘_mm_extract_epi16’ [-Wimplicit-function-declaration]
                    ksw.c: In function ‘ksw_i16’:
                    ksw.c:228:2: error: unknown type name ‘__m128i’
                    ksw.c:244:2: warning: implicit declaration of function ‘_mm_set1_epi16’ [-Wimplicit-function-declaration]
                    ksw.c:256:3: error: unknown type name ‘__m128i’
                    ksw.c:260:4: warning: implicit declaration of function ‘_mm_adds_epi16’ [-Wimplicit-function-declaration]
                    ksw.c:262:4: warning: implicit declaration of function ‘_mm_max_epi16’ [-Wimplicit-function-declaration]
                    ksw.c:266:4: warning: implicit declaration of function ‘_mm_subs_epu16’ [-Wimplicit-function-declaration]
                    ksw.c:282:5: warning: implicit declaration of function ‘_mm_cmpgt_epi16’ [-Wimplicit-function-declaration]
                    make: *** [ksw.o] Error 1

                    Do you know why this is happening?

                    Comment

                    • jmwhitha
                      Senior Member
                      • Mar 2013
                      • 107

                      #11
                      Sorry, I forgot to answer your other questions.

                      Yes, I am. Desktop. Running natively.

                      Comment

                      • GenoMax
                        Senior Member
                        • Feb 2008
                        • 7142

                        #12
                        Originally posted by jmwhitha View Post

                        Yes, I am. Desktop. Running natively.
                        Can you post the output of:

                        Code:
                        uname -a
                        I am wondering what linux distribution of a recent vintage does not come with a functional compiler? What exact distro of linux are you using?

                        Comment

                        • jmwhitha
                          Senior Member
                          • Mar 2013
                          • 107

                          #13
                          Linux Linux-OptiPlex-755 3.5.0-27-generic #46-Ubuntu SMP Mon Mar 25 20:00:05 UTC 2013 i686 i686 i686 GNU/Linux

                          I hope that is the case. If it is, what compiler should I get? I have the latest version of protobuf-compiler according to apt-get.

                          Comment

                          • jmwhitha
                            Senior Member
                            • Mar 2013
                            • 107

                            #14
                            I also did the build-essentials.

                            Comment

                            • GenoMax
                              Senior Member
                              • Feb 2008
                              • 7142

                              #15
                              I wonder if you have some kind of software conflict with compilers.

                              Code:
                              sudo apt-get install gcc
                              should have been all that was needed

                              Comment

                              Latest Articles

                              Collapse

                              • SEQadmin2
                                Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                                by SEQadmin2



                                Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                                ...
                                07-09-2026, 11:10 AM
                              • SEQadmin2
                                Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                                by SEQadmin2



                                Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                                There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                                07-08-2026, 05:17 AM
                              • GATTACAT
                                Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
                                by GATTACAT
                                Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
                                07-01-2026, 11:43 AM

                              ad_right_rmr

                              Collapse

                              News

                              Collapse

                              Topics Statistics Last Post
                              Started by SEQadmin2, 07-13-2026, 10:26 AM
                              0 responses
                              20 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-09-2026, 10:04 AM
                              0 responses
                              30 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-08-2026, 10:08 AM
                              0 responses
                              18 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-07-2026, 11:05 AM
                              0 responses
                              34 views
                              0 reactions
                              Last Post SEQadmin2  
                              Working...