[NextGenSeq]

Bioo Scientific has a kit with 48 barcodes that's available now.

[Garyron]

Hi All,
Has anyone made directional libraries from bacterial mRNA using Truseq small RNA adapters? Any information on this will be helpful

Thanks

[kaiman]

Truseq genomic library

I have problems with the Truseq library kit. Some of my libraries work, some don't. I did size selection on e-gel and have very good gel recovery. However, some of the PCR didn't work. These libraries use different index adapters. Is it an index related ligation problem?

If you have experience with truseq genomic library kit, please share the experience with me.

Thanks

[ETHANol]

I don't personally have any expertise in regards to your question, but take a look at this thread. Seems some other people have had problems with e-gels and TruSeq.

http://seqanswers.com/forums/showthread.php?t=9124

[Howie Goodell]

A bioinformatics question with chemistry inputs: I am trying to convert RNAseq cDNA Bioanalyzer read sizes to the correct TopHat read spacing (-r parameter). I used to subtract the sum of the lengths of the Illumina Paired-End adapters plus the sum of the number of bases read to get the read separation (negative if there's overlap). I'm trying to figure out how this should be adjusted now that we are using the TrueSeq kits with multiplexed adapters. I have their sequences, but I'm not sure exactly what's on each end of the molecule when it is Bioanalyzed. I know a TruSeq Adapter (all length 64) is ligated on the 5' end. No TruSeq Universal Adapter (length 59) "Y" at that point, right? My main question is what's on the 3' end -- the old PE second read adapter (33 bp), or something else?

Thanks!

[Howie Goodell]

Oh, and one more aspect: TopHat also has a standard deviation parameter (--mate-std-dev ). The TruSeq adapter peaks often seem much wider on the Bioanalyzer. I assume that means we need a broader pair search zone in TopHat, then?

[genlyai]

The Truseq Y adapter is ligated on both sides, so after pcr, you have the top strand of the Y on one end and the bottom strand on the other.

Regarding your second question, I believe it should be larger, but I think the easiest thing to do is just to align a fraction of your lib with loose parameters and estimate the sd from there.

[pmiguel]

A bioinformatics question with chemistry inputs: I am trying to convert RNAseq cDNA Bioanalyzer read sizes to the correct TopHat read spacing (-r parameter). I used to subtract the sum of the lengths of the Illumina Paired-End adapters plus the sum of the number of bases read to get the read separation (negative if there's overlap). I'm trying to figure out how this should be adjusted now that we are using the TrueSeq kits with multiplexed adapters.

The lib ".hist" file produced by abyss-pe on genomic TruSeq v1 libs seems to have the size distribution 50-80 bp shorter than what I see on Agilient Bioanalyzer (HS DNA) chips of the PCR "enriched" libraries.

I have their sequences, but I'm not sure exactly what's on each end of the molecule when it is Bioanalyzed. I know a TruSeq Adapter (all length 64) is ligated on the 5' end. No TruSeq Universal Adapter (length 59) "Y" at that point, right? My main question is what's on the 3' end -- the old PE second read adapter (33 bp), or something else?

Thanks!

Just to be clear: if these are generic RNA TruSeq libraries then double stranded cDNA is ligated to the Y-adapters. Meaning, the strand-context of the original mRNA is lost.

If by 5' and 3' you refer to the amplicon strand that binds to the flow cell oligo, then the "3'" end has the index sequence priming site, the index, then the amplification priming site. The reverse complement of the index sequence priming site also serves as the second read priming site for PE sequencing.

--
Phillip

[pmiguel]

I should add, I it is possible that Illumina is putting some extra bases on the distal ends of their enrichment PCR oligos (PPC -- PCR Primer Cocktail in the TruSeq kits). But this is mainly based on the apparent size of the PPC oligos when run on an RNA (Pico) chip being around 80 nt.

Has anyone cloned and Sanger sequenced any TruSeq amplicons? The extra sequence, it it exists, should be visible there.
--
Phillip

[ECO]

This is a great document, I wanted to add to this thread:

http://genomics.med.tufts.edu/documents/protocols/TUCF_Understanding_Illumina_TruSeq_Adapters.pdf

[QTLdum]

Actually, we did some Sanger sequencing and found that the TruSeq Universal Adapter sequence has a deviation from the sequence indicated in the previous thread. We sequenced multiple fragment forward and reverse and the sequence always was AATGATACGGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT indicating a G insertion. Maybe, this was restricted to the specific adapter charge we purchased.

[aleferna]

I'm still waiting on the response from illumina, they sent me a document where they mix all the adapters, but I can't really tell apart which ones are illumina and which ones are Nextera V2. Does anybody know what are the adapter and primer sequences of the new nextera kit? Why is Illumina making it so hard to find this out, don't they know you can just sequence the kit with sanger seq and be done with it? Whats the big deal? They are just making their customers angry, if you really want to copy the nextera and sell generic "primers" I think you would just spend the time to sequence them no?

[vtosha]

Hi All,
Has anyone made directional libraries from bacterial mRNA using Truseq small RNA adapters? Any information on this will be helpful

Thanks

We have done directional libraries from bacterial mRNA using Truseq small RNA. If you have interested yet I can tell about them.

[carmeyeii]

Illumina has the Stranded and Non-Stranded TruSeq RNAKits.

i don't know if the adapter Indices are the same for both kits, but I could not find which sequences the Stranded Kits use, until I found this document at Illumina.

Just in case anyone is looking for the same info.

Note that TruSeq Stranded RNA-seq Kits come in HT and LT (for throughput), and the latter includes 24 total unique indices, while the former has 96.

C

[pmiguel]

Illumina has the Stranded and Non-Stranded TruSeq RNAKits.

i don't know if the adapter Indices are the same for both kits, but I could not find which sequences the Stranded Kits use, until I found this document at Illumina.

Just in case anyone is looking for the same info.

Note that TruSeq Stranded RNA-seq Kits come in HT and LT (for throughput), and the latter includes 24 total unique indices, while the former has 96.

C

Keep in mind the HT adapters are dual indexed. So those require extra chemistry for HiSeq High Output runs. (Although they run without any special measures on the MiSeq and, I think, on the HiSeq using Rapid chemistry.)