[Diegodescarpates]

I haven't done it yet, but based on the discussion above, I like the idea of removing the external adapters first, then going back for the internal ones - I think this will work:

cutadapt -a GATCGGAAGAGCACACGTCTGAACTCCAGTCAC -m 20 $fastq1 | cutadapt -b CTGTCTCTTATACACATCT -b AGATGTGTATAAGAGACAG -m 20 > $fastq1_trimmed

cutadapt -a GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -m 20 $fastq2 | cutadapt -b CTGTCTCTTATACACATCT -b AGATGTGTATAAGAGACAG -m 20 > $fastq2_trimmed

This would be followed by steps to ensure pairs in each file. I use novoalign to align which allows alignment of two orientations.

Thoughts?

It works perfectly for me ! Thanks a lot !
Diego'

[hartmaier]

It works perfectly for me ! Thanks a lot !
Diego'

Awesome. I have also used it successfully now. I've also found a neat little unix trick to allow both files to run at the same time (in order to utilize multiple processors) - see below. The '2>$1 | cat' is a little trick I found in another message board and redirects stderror to stdout and only moves onto the next step in a pipeline once both are finished...this effectively halves the time for trimming since both run at once.

(
cutadapt ... > fastq1_trimmed &
cutadapt ... > fastq2_trimmed &
) 2>$1 | cat

Also, remember that trimming will almost always produce orphan reads which will cause error when you align. I immediately send trimmed output to the filtering script found here: http://seqanswers.com/forums/showthread.php?t=24076

You are now ready to send to your favorite aligner.

[Diegodescarpates]

(
cutadapt ... > fastq1_trimmed &
cutadapt ... > fastq2_trimmed &
) 2>$1 | cat

Hi all,

Could anyone provide a perl script solution for this task ?

Thanks !

Diego'

[MesutOezil]

Can this tool, NextClip, be a good option for Nextera mate-pair sequencing data analysis?

http://www.ncbi.nlm.nih.gov/pubmed/24297520

(although I have not tested it yet)

[hartmaier]

Can this tool, NextClip, be a good option for Nextera mate-pair sequencing data analysis?

http://www.ncbi.nlm.nih.gov/pubmed/24297520

(although I have not tested it yet)

Thanks for sharing. I haven't seen NextClip. After a quick read it really appears the adapter trimming strategy seems similar to what came about in this thread. However, it appears to be making tradeoffs for the sake of de novo builds. For example, placing emphasis on reads with the junction adapter. This is very conservative. My final Nextera libraries have an average size of 700-800 base pairs (and extending well past 1kb). Since the shearing is random, the junction adapter can occur anywhere in this fragment. Standard 100bp paired end sequencing will likely miss the junction adapter in many fragments. They do (kind of) mention this is the discussion. The PCR duplication rate is very important but there are other tools already available for that (picard tools). I align with Novoalign which allows 2 insert sizes to be specified, allowing for "paired-end" contaminants to be aligned and excluded from downstream analyses. That said, the Nextera seems much, much better in this regard to the previous Illumina mate pair kit.
So, my take away…if you don't have a reference, or you are doing a de novo build, this is probably useful, although at some cost.

[relipmoc]

Now skewer can handle Nextera Long Mate Pair (LMP) reads, trimming all the adapters elegantly.

skewer is very easy to use. Please have a try!