Hi,
I am doing a primer design recently, and using the primer 3 to do the primer design. But get a warning at the end:
CGGCGCCGAGCCCCGCCGGGGTGAGCTGGG
Which looks like a CGG Hairspin. Many people tell me that *might* cause the pcr amplification failure. But why...


Thanks in advance.
I am doing a primer design recently, and using the primer 3 to do the primer design. But get a warning at the end:
CGGCGCCGAGCCCCGCCGGGGTGAGCTGGG
Which looks like a CGG Hairspin. Many people tell me that *might* cause the pcr amplification failure. But why...



Thanks in advance.
Comment