Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • frymor
    Senior Member
    • May 2010
    • 151

    running DEXSeq with hisat2 created bam files

    Hi,

    I am trying to run DEXSeq with bame files made by the hisat2 mapper. I have created the gff file according to the manual. I have seen that the chromosome names are different from the bam files, so I have awk-modified them. now they both look similar.

    I have attached here the first 1000 rows of the gff file as well as 400 of the bam file from hisat2.
    here are the first few rows of both files:
    Code:
    [B]gff[/B]:
    1       dexseq_prepare_annotation.py    aggregate_gene  11869   14409   .       +       .       gene_id "ENSG00000223972.5"
    1       dexseq_prepare_annotation.py    exonic_part     11869   12009   .       +       .       transcripts "ENST00000456328.2"; exonic_part_number "001"; gene_id "ENSG00000223972.5"
    1       dexseq_prepare_annotation.py    exonic_part     12010   12057   .       +       .       transcripts "ENST00000450305.2+ENST00000456328.2"; exonic_part_number "002"; gene_id "ENSG00000223972.5"
    1       dexseq_prepare_annotation.py    exonic_part     12058   12178   .       +       .       transcripts "ENST00000456328.2"; exonic_part_number "003"; gene_id "ENSG00000223972.5"
    1       dexseq_prepare_annotation.py    exonic_part     12179   12227   .       +       .       transcripts "ENST00000450305.2+ENST00000456328.2"; exonic_part_number "004"; gene_id "ENSG00000223972.5"
    1       dexseq_prepare_annotation.py    exonic_part     12613   12697   .       +       .       transcripts "ENST00000450305.2+ENST00000456328.2"; exonic_part_number "005"; gene_id "ENSG00000223972.5"
    
    [B]bam[/B]:
    SOLEXA3_1:8:54:9864:6930/2      433     1       10536   1       50M     16      90128665        0       TACCCCCGAAATCTGTGCAGAGGAGAACGCAGCTCCGCCCTCGCGGTGCT      ##################################################      AS:i:-4 ZS:i:-4 XN:i:0  XM:i:2  XO:i:0  XG:i:0NM:i:2   MD:Z:4A19C25    YT:Z:UP NH:i:8
    SOLEXA3_1:8:96:12216:10104/2    401     1       10536   1       50M     =       532371  0       TACCACCGAAATCTGTGCAGAGGAGAACGCAGCTCCGCCCTCGCGGTGCT      BBCB<>=@:=)BCCCBCCDC@@@@:C>C@CCCCCC@CCCBACCBCCCCCC      AS:i:-4 ZS:i:-4 XN:i:0  XM:i:1  XO:i:0  XG:i:0  NM:i:1MD:Z:24C25       YT:Z:UP NH:i:6
    SOLEXA3_1:8:38:7825:12181/2     177     1       10537   1       50M     2       61785065        0       ACCACCGAAATCTGTGCAGAGGAGAACGCAGCTCCGCCCTCGCGGTGCTC      #########B-A6=0;6<:6:66:*;34:.ABBA?7>AA=ABC?C@DBCC      AS:i:-4 ZS:i:-4 XN:i:0  XM:i:1  XO:i:0  XG:i:0NM:i:1   MD:Z:23C26      YT:Z:UP NH:i:6
    SOLEXA3_1:8:102:12459:18067/1   337     1       10540   1       50M     19      238009  0       ACCGAAATCTGTGCAGAGGAGAACGCAGCTCCGCCCTCGCGGTGCTCTCC      BCCCCCC@CCCCCCCCCCCCCCCCCCCBCCCCCCCCCCCCCCCCCCCCCC      AS:i:-5 ZS:i:-5 XN:i:0  XM:i:1  XO:i:0  XG:i:0  NM:i:1MD:Z:20C29       YT:Z:UP NH:i:4
    SOLEXA3_1:8:63:4265:15899/2     153     1       10565   255     50M     =       10565   0       CAGCTCCGCCCTCGCGGTGCTCTCCGGGTCTGTGCTGAGGAGAACGCAAC      A@<BB=B@BB2/5..(*0*/>CB>@BBC@B??;?9?C=C=<<78:;<;;<      AS:i:0  ZS:i:-2 XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0MD:Z:50  YT:Z:UP NH:i:1
    When running the command:
    Code:
    python ~/R/x86_64-pc-linux-gnu-library/3.2/DEXSeq/python_scripts/dexseq_count.py -p yes gencode.v23.annotation.mod.gff $file DEXSeq_completeSample/$NEW_FILE.txt
    I keep getting the following error message:
    Code:
    Traceback (most recent call last):
      File "/home/yeroslaviz/R/x86_64-pc-linux-gnu-library/3.2/DEXSeq/python_scripts/dexseq_count.py", line 215, in <module>
        for af, ar in HTSeq.pair_SAM_alignments( reader( sam_file ) ):
      File "/usr/local/lib/python2.7/dist-packages/HTSeq-0.6.1p1-py2.7-linux-x86_64.egg/HTSeq/__init__.py", line 601, in pair_SAM_alignments
        for almnt in alignments:
      File "/usr/local/lib/python2.7/dist-packages/HTSeq-0.6.1p1-py2.7-linux-x86_64.egg/HTSeq/__init__.py", line 536, in __iter__
        algnt = SAM_Alignment.from_SAM_line( line )
      File "_HTSeq.pyx", line 1276, in HTSeq._HTSeq.SAM_Alignment.from_SAM_line (src/_HTSeq.c:24611)
    ValueError: ('SAM line does not contain at least 11 tab-delimited fields.', 'line 1 of file hisat2.bamFiles/610W1AAXX_8.sorted.bam')
    the first line of the bam file looks like that:
    Code:
    SOLEXA3_1:8:54:9864:6930/2      433     1       10536   1       50M     16      90128665        0       TACCCCCGAAATCTGTGCAGAGGAGAACGCAGCTCCGCCCTCGCGGTGCT      ##################################################      AS:i:-4 ZS:i:-4 XN:i:0  XM:i:2  XO:i:0  XG:i:0NM:i:2   MD:Z:4A19C25    YT:Z:UP NH:i:8
    Has anyone ever tried to run DEXSeq with the hisat2 output?
    Is there a difference to the "standard" sam/bam format?

    I would appreciate any help solving this error message.

    thanks
    Assa
    Attached Files

Latest Articles

Collapse

  • SEQadmin2
    Nine Things a Sample Prep Scientist Thinks About Before Sequencing
    by SEQadmin2


    I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.

    Here are nine questions we think about, in roughly the order they matter, before...
    06-18-2026, 07:11 AM
  • SEQadmin2
    From Collection to Sequencing: Why Sample Preparation and Preservation Define Sequencing Data
    by SEQadmin2


    Data variability is still an issue in sequencing technologies despite the advances in reproducibility and accuracy of these platforms. But the problem does not originate in the sequencing itself, but in the previous steps, before the sample reaches the sequencer.


    The first step is collection, followed by preservation and sample preparation for analysis. Most scientists overlook those steps, but not being careful might just be skewing the experiment’s results.
    ...
    06-02-2026, 10:05 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by SEQadmin2, 06-26-2026, 11:10 AM
0 responses
14 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 06-17-2026, 06:09 AM
0 responses
48 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 06-09-2026, 11:58 AM
0 responses
107 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 06-05-2026, 10:09 AM
0 responses
125 views
0 reactions
Last Post SEQadmin2  
Working...