Thanks kmcarr!
Unconfigured Ad
Collapse
This topic is closed.
X
X
-
-
@frymor's question is also posted (and possibly answered) on Biostars: https://www.biostars.org/p/167555/
Comment
-
You don't have to view them on the server. The files are self contained and can be transferred to local desktop PC/Mac for stand-alone examination. That said you can use any browser available on the server to view them. On some clusters/servers admins insist on not installing browsers so downloading them locally may be the best option.Originally posted by daanum View PostHi ,
I am using a Linux GNU server. How can I view the.html files which are generated as a result of fastqc, on the linux server?
Thank you.
Comment
-
Indeed, probably the single nicest feature about FastQC is that the html files have the images embedded, making it really convenient to do this.Originally posted by GenoMax View PostYou don't have to view them on the server. The files are self contained and can be transferred to local desktop PC/Mac for stand-alone examination.
Comment
-
Hello Simon & all,
first of all, I'd like to thank you for a fantastic tool - this is truly the most important tool for the most important step in whole NGS process, and it does its job fantastically well.
second, I would like to ask if there is a collection of people's failed (or peculiar) results, obtained with FastQC and later explained. I've already seen https://sequencing.qcfail.com and I'm studying it right now, but it also seems that everybody would benefit from a wiki-like resource, where everybody can contribute (and discuss) the results. What do you think?
Finally, I was curious about running Fastqc on IonTorrent results. It concerns me that the reads are all of different lengths & I never quite took the time to understand the exact math used in various Fastqc metrics (such as k-mer and overrepresented sequences evaluation). Thus if anything pops to anyone's mind about what sort of things to expect, what extra option to use, or what to do differently, I would greatly appreciate it.
Comment
-
QCFail is our attempt to provide some kind of collation of the types of failures we see in sequencing experiements, not just stuff you could spot with FastQC, but all through the analysis pipeline. We discussed a lot of different options for how to handle this (wikis, databases and various automated systems), but in the end since the number of failure modes is relatively limited we decided that the sort of tagged blog format + search was the most useful starting point. It may be that once we've got the system populated that we might look to find ways to direct people to relevant articles more easily so the information is more readily accessible when you see your problematic data, but that's something to work out in the future (unless anyone else fancies having a go!).Originally posted by apredeus View PostHello Simon & all,
first of all, I'd like to thank you for a fantastic tool - this is truly the most important tool for the most important step in whole NGS process, and it does its job fantastically well.
second, I would like to ask if there is a collection of people's failed (or peculiar) results, obtained with FastQC and later explained. I've already seen https://sequencing.qcfail.com and I'm studying it right now, but it also seems that everybody would benefit from a wiki-like resource, where everybody can contribute (and discuss) the results. What do you think?
Finally, I was curious about running Fastqc on IonTorrent results. It concerns me that the reads are all of different lengths & I never quite took the time to understand the exact math used in various Fastqc metrics (such as k-mer and overrepresented sequences evaluation). Thus if anything pops to anyone's mind about what sort of things to expect, what extra option to use, or what to do differently, I would greatly appreciate it.
For your Ion Torrent data you shouldn't need to do anything different to work with that. For the overrepresented sequences we only take up to the first 50bp of each read anyway as we're using an exact matching strategy to count duplicates, so if you allow longer lengths then your results get increasingly messed up by mis-calls, and 50bp is normally enough to establish that it's the same sequence.
Comment
-
fastQC
Dear Simon, I have the same problem with my fastq file (from nanopore sequencing). Please, could you provide the link for download the fastQC version0.11.3 for Mac? Many thanks!!!Originally posted by simonandrews View PostAaargh - I'd forgotten that one of the other pending fixes for the next release was that the disable didn't work for the per-tile module (it will actually disable it if you turn of the adapter module as it was reading the wrong parameter).
I've just put up a development snapshot at http://www.bioinformatics.babraham.a...11.3_devel.zip which contains the fix for both of these issues. You should be able to use that to process these files.
Comment
-
Currently available version is 0.11.5 (newer than this one) so it should have the fix in it. Can you try downloading that?Originally posted by Roxana View PostDear Simon, I have the same problem with my fastq file (from nanopore sequencing). Please, could you provide the link for download the fastQC version0.11.3 for Mac? Many thanks!!!
Comment
-
Dear genoMax,
I tried to running in the version 0.11.5, but it is not working with my fastq file (from nanopore sequencing). Please, see below the error:
my fastq file have the following structure:Code:[rzz1@spectre14 ~]$ Picked up JAVA_TOOL_OPTIONS: -XX:MaxHeapSize=2048m Exception in thread "Thread-1" java.lang.OutOfMemoryError: Java heap space at uk.ac.babraham.FastQC.Utilities.QualityCount.<init>(QualityCount.java:33) at uk.ac.babraham.FastQC.Modules.PerBaseQualityScores.processSequence(PerBaseQualityScores.java:141) at uk.ac.babraham.FastQC.Analysis.AnalysisRunner.run(AnalysisRunner.java:88) at java.lang.Thread.run(Thread.java:748)
This fastq file is a bit different from Illumina, and I am thinking that this fastq is not working in the last version of fastQC.Code:@9157abfa-c2e8-4d54-a323-11162850dcbf runid=4243c40e101f8b1c6aa3337f2ef28b72eef6091c read=5 ch=78 start_time=2017-05-19T15:31:04Z ATTTATGTTCTTGGCCCCCACACATTGTGGCCCCCATTGTTGTGTGTGTGTTATTTGACCCTTGTATTTGTATTGTTATTGTGTTATTGTTGGCCCCATTATTGTGTGTGTATTATTGTTATTTGACCCATTGTTGTATTGTGTGTGACTTGTGTGTGTGTATTATTGTTATTGTGTATTATTTGTGTGTGTGTGTGTGTGCTTGTTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTCTCTATACTCTATATATATATACCTATATACTCTTCTTCTTCTTCTCTTCTTTCTCTCTTATGTCTTTCTCTTCTCTTCTTCTTATACCACTTCTTCTTCTATTCTAATAAATTAGGATGGGAGGAGGATGGATGGGTTCAAGGATAGTTCAATGAATACAAGGAGAGGAAAAAGGATC + $''$#&$&'$''""$$$$$#$#%%)+&)&%&(())'..')(%)&'$*&)#&+$(*('$%(')*%*"')+#'#*,$,*$*)%&%()#,(&1+('()('(+4'/*()$'#%#'#'+(./'.+$('(((,,,)08*,(#+',,(*'*'+*')0.)''*')%)%'"&&%(*#&'%*'%%#)#()).>-)++,*&(,,,+))'(%$&--&+.)+**)*+,,-++*-./22+,(,(-)*'.-.*)(&%,(%$),'($%%)%&%&)"*#'$*&&%%#$#%%%$'$%''*)&(,%('%(+&'$$&"$#%%&%&$(%$'"($&%*$'$''$'$'(%(+%($&%%&%%%&($'-$(+%&$%&#%%%%$&%##$%%$#$%$#$#$$##$####$$$#$##$$#$%$"$&#%$#"%&#%#%#$$&%&$%%%%&&%&$'#
Many thanks for any advice.
Roxana
Comment
-
Hi Roxana,
We've been debugging the same error earlier this afternoon, also with nanopore data. The error is because FastQC is running out of memory due to the long reads (I presume).
You can allocate more memory for FastQC by increasing the number of threads - it gets 250MB memory per thread. Our data worked when we ran with four threads:
PhilCode:fastqc -t 4 input.fastq
Comment
Latest Articles
Collapse
-
by SEQadmin2
Researchers using sequencing and genomics tools often have to make trade-offs. They can choose between speed or scale, short reads or long-range information, or targeted panels or a view of the whole transcriptome. New technologies that have been released this year are built to address those tough choices.
We asked six companies the same four questions to learn about their latest products. The new technologies bring a lot to the table, including rethinking sequencing...-
Channel: Articles
-
ad_right_rmr
Collapse
News
Collapse
| Topics | Statistics | Last Post | ||
|---|---|---|---|---|
|
Started by SEQadmin2, 09-29-2026, 09:51 AM
|
0 responses
16 views
0 reactions
|
Last Post
by SEQadmin2
09-29-2026, 09:51 AM
|
||
|
Started by SEQadmin2, 09-25-2026, 09:06 AM
|
0 responses
39 views
0 reactions
|
Last Post
by SEQadmin2
09-25-2026, 09:06 AM
|
||
|
Started by SEQadmin2, 09-23-2026, 11:05 AM
|
0 responses
30 views
0 reactions
|
Last Post
by SEQadmin2
09-23-2026, 11:05 AM
|
||
|
Started by SEQadmin2, 09-18-2026, 11:37 AM
|
1 response
50 views
0 reactions
|
Last Post
by pekgio
09-21-2026, 02:04 AM
|
Comment