Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • super0925
    Senior Member
    • Feb 2014
    • 206

    #1

    htseq-count error RNAME == '*' although flag bit &0x0004 cleared"

    Hi all

    I do rna-seq , after tophat mapping, I got 6 aligned.bam file . And I played them by Cuffdiff, it works. However, if I try Htseq-count on 6 aligned.bam file (I have sorted and transfer it to SAM), one of them have error and hence I cannot get the counts table.

    The error is

    Error occured when processing SAM input (line 4241616 of file aligned_sn.sam): ("Malformed SAM line: RNAME == '*' although flag bit &0x0004 cleared", 'line 4241616 of file aligned_sn.sam') [Exception type: ValueError, raised in _HTSeq.pyx:1294]

    I check the line 4241616 of SAM file, it is

    B500959:23:HW5G2BGXX:1:21303:20052:4160 0 * 411525 50 22M1949N18M * 0 0 AAAGAATCAAGAGCTGCAGCGGGCAAGGCAGAGAGAGAAG AAAAAEEEEE6EEEEAEEEEEEEE/EE<EEEEAEEEEEEE AS:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:0G18T20 NM:i:2 XS:A:+ NH:i:1
    I don't know why does it happen because it is first time I have this error, I am very confused. I know RNAME == '*' means an unmapped segment without coordinate.

    Now I want to know

    (1)Why does it happen?
    (2)What will I do?

    Thank you!
  • dpryan
    Devon Ryan
    • Jul 2011
    • 3478

    #2
    Somehow you corrupted your BAM file, that alignment your showed shouldn't exist. Go back through your processing and try to determine when this alignment was introduced in this form and correct however that was done. My guess is that at some point you changed a BAM header and jumbled things up.

    Comment

    • super0925
      Senior Member
      • Feb 2014
      • 206

      #3
      Originally posted by dpryan View Post
      Somehow you corrupted your BAM file, that alignment your showed shouldn't exist. Go back through your processing and try to determine when this alignment was introduced in this form and correct however that was done. My guess is that at some point you changed a BAM header and jumbled things up.
      1.Do you mean I need to re-map the sample?
      2. Doe it mean that My cuffdiff could also potentially have problem?
      I ran 6 samples in a loop (Mapping, sorting BAM, Counting Reads)and hence I think the error shouldn't happen. But it happened, strange....
      Thank you!

      Comment

      • dpryan
        Devon Ryan
        • Jul 2011
        • 3478

        #4
        Originally posted by super0925 View Post
        1.Do you mean I need to re-map the sample?
        2. Doe it mean that My cuffdiff could also potentially have problem?
        I ran 6 samples in a loop (Mapping, sorting BAM, Counting Reads)and hence I think the error shouldn't happen. But it happened, strange....
        Thank you!
        1. Maybe, depends on where the problem occurred.
        2. I wouldn't trust the cuffdiff results if you fed it this file.

        Comment

        • super0925
          Senior Member
          • Feb 2014
          • 206

          #5
          Originally posted by dpryan View Post
          1. Maybe, depends on where the problem occurred.
          2. I wouldn't trust the cuffdiff results if you fed it this file.
          OK. I will try re-run it.
          I use
          Code:
          tophat2 -o outdir  --library-type fr-firststrand --keep-fasta-order --GTF genes.gtf  genome.fa Trimmed.fastq
          and get the aligned.bam, which I don't think there are any problems.
          However, Cuffdiff got the differential expression results on the bam file I talked above, which is beyond my expection...

          Comment

          • super0925
            Senior Member
            • Feb 2014
            • 206

            #6
            Originally posted by dpryan View Post
            1. Maybe, depends on where the problem occurred.
            2. I wouldn't trust the cuffdiff results if you fed it this file.
            Sorry I got SAME error!!
            I re-run the tophat, get the accepted_hits.bam , command is as follows:

            Code:
            [B]tophat2 -o outdir  --library-type fr-firststrand --keep-fasta-order --GTF genes.gtf  genome.fa Trimmed.fastq
            samtools sort -o aligned.bam -n -@ 8 accepted_hits.bam
            samtools view -o aligned.sam aligned.bam
            htseq-count -s yes aligned.sam genes.gtf>subset[/B]
            But I still get the error:

            Error occured when processing SAM input (line 4240949 of file Hor_sn.sam):
            ("Malformed SAM line: RNAME == '*' although flag bit &0x0004 cleared", 'line 4240949 of file Hor_sn.sam')
            [Exception type: ValueError, raised in _HTSeq.pyx:1294]


            But this time is not 'line 4241616' but 'line 4240949 '. both SAM files have 1 row with '*' at column 3, on line 4241616 and 4240949 , respectively.
            Last edited by super0925; 04-29-2016, 07:18 AM.

            Comment

            • dpryan
              Devon Ryan
              • Jul 2011
              • 3478

              #7
              Weird, I assume this same alignment is in the original "accepted_hits.bam" file. What happens if you don't specify "--keep-fasta-order"?

              Comment

              • super0925
                Senior Member
                • Feb 2014
                • 206

                #8
                Originally posted by dpryan View Post
                Weird, I assume this same alignment is in the original "accepted_hits.bam" file. What happens if you don't specify "--keep-fasta-order"?
                Hi D
                I tried it, but still get the error.
                "Error occured when processing SAM input (line 4240949 of file aligned.sam):
                ("Malformed SAM line: RNAME == '*' although flag bit &0x0004 cleared", 'line 4240949 of file aligned.sam')
                "
                What is your suggestion?
                Leave it and only stick to Cuffdiff? Or remove this line in SAM and to do HTseq and edgeR?
                Thank you!

                Comment

                Latest Articles

                Collapse

                • SEQadmin2
                  Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                  by SEQadmin2



                  CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                  Despite this, “CRISPR helped turn genome editing from a specialized technique into
                  ...
                  07-31-2026, 11:01 AM
                • SEQadmin2
                  Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                  by SEQadmin2


                  Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                  The systematic characterization of the human proteome has
                  ...
                  07-20-2026, 11:48 AM

                ad_right_rmr

                Collapse

                News

                Collapse

                Topics Statistics Last Post
                Started by SEQadmin2, Today, 10:35 AM
                0 responses
                4 views
                0 reactions
                Last Post SEQadmin2  
                Started by SEQadmin2, 08-06-2026, 07:41 AM
                0 responses
                23 views
                0 reactions
                Last Post SEQadmin2  
                Started by SEQadmin2, 08-03-2026, 10:13 AM
                0 responses
                41 views
                0 reactions
                Last Post SEQadmin2  
                Started by SEQadmin2, 07-31-2026, 02:55 AM
                0 responses
                47 views
                0 reactions
                Last Post SEQadmin2  
                Working...