Hi,
I was wondering if someone can explain/ give hints to me about how to regain a de Bruijn Graph from Velvet's LastGraph representation of nodes and arcs?
I created an example with hashsize (k)=7 and told velvetg to "keep all data" by setting cov_cutoff=1 min_contig_lgth=1:
results in
I don't get exactly HOW to read out the sequence from the traversal of the nodes, e.g. (1) --> (-1), (-1) --> (2) and so on.
Once I know how to read the sequence I could rebuild a simple de Bruijn Graph from it. Or is there maybe some simpler (back-)transformation from LastGraph to de Bruijn Graph?
The (very old) manual page of Velvet is not helping too much
Any help highly appreciated.
Thanks!
------------------------------
EDIT
------------------------------
Another example:
Let's take a sequence s=ACTGGACTGAA
As I recall this results in the dBG of s:
Velvet's result is (k=3, velvetg cov_cutoff=1 min_contig_lgth=1):
1 1 3 1
NODE 1 5 7 7 0 0
TGGAC
CCAGT
ARC 1 1 1
This means I would be able to recover:
BUT, it seems to me that Velvet is missing the entire alternative path "TGAA" of the dBG of s.
I would have expected another node and an additional arc to find that sequence.
Am I right until here? Do I miss some/ should I change some parameter?
I was wondering if someone can explain/ give hints to me about how to regain a de Bruijn Graph from Velvet's LastGraph representation of nodes and arcs?
I created an example with hashsize (k)=7 and told velvetg to "keep all data" by setting cov_cutoff=1 min_contig_lgth=1:
Code:
>SEQUENCE_0 TTTTTTCATGCATGCTAGCGTGTGTGTGT >SEQUENCE_1 GTGTGTGTGTTAGCTGCAGTATGCGGAAC >SEQUENCE_2 ACACACACACATCGATTGTTATGCGGAAC >SEQUENCE_3 TATGCGGAACGCATTGCTAACTCGGGGGG
Code:
5 4 7 1 NODE 1 12 13 13 0 0 GCTAGCATGCAT GCTAGCGTGTGT NODE 2 1 6 6 0 0 G C NODE 3 1 7 7 0 0 T A NODE 4 15 15 15 0 0 TAGCTGCAGTATGCG CTGCAGCTAACACAC NODE 5 14 14 14 0 0 TCGATTGTTATGCG ACAATCGATGTGTG ARC 1 -1 2 ARC -1 2 1 ARC 2 3 6 ARC -2 -3 4 ARC 3 4 1 ARC -3 5 1
Once I know how to read the sequence I could rebuild a simple de Bruijn Graph from it. Or is there maybe some simpler (back-)transformation from LastGraph to de Bruijn Graph?
The (very old) manual page of Velvet is not helping too much

Any help highly appreciated.
Thanks!
------------------------------
EDIT
------------------------------
Another example:
Let's take a sequence s=ACTGGACTGAA
As I recall this results in the dBG of s:
Code:
ACT --> CTG --> TGG --> GGA --> GAC --> (ACT...)
|
|--> TGA --> GAA
1 1 3 1
NODE 1 5 7 7 0 0
TGGAC
CCAGT
ARC 1 1 1
This means I would be able to recover:
Code:
(Node 1 upper seq.) TGGAC
||| --> ACTGGAC (and an arbitrary amount of concatenations of this seq. since ARC (1) --> (1) )
(Node 1 lower seq. rev.comp.) ACTGG
I would have expected another node and an additional arc to find that sequence.
Am I right until here? Do I miss some/ should I change some parameter?