Originally posted by GenoMax
View Post
Unconfigured Ad
Collapse
X
-
Dear Brian,
I am using bbmap for mapping and callvariants.sh for variant calling on PE Illumina reads.
I am comparing two mice strains. I am therefore downsampling my .sam files to have the same number of mapped reads going into the alignment.
When I input the original file containing ~680k mapped PE reads I get 2283 variants. When I run the down sampled file containing ~200k mapped PE reads I get 3375 variants.
I would expect to get a lower number of variants when I put in less reads. Could you explain this to me? I am clearly missing something that might be important for my analysis
(I am using the exact same criteria for variant calling and filtering for the two samples)
Comment
-
-
I am trying to run BBmap on the cluster, but got the error below. Can anyone help me to solve the error?
Thanks,
[hgx080@quser10 DNA_all]$ /home/hgx080/bbmap/bbmap.sh ref=/projects/b1052/Wells_b1042/GaoHan/CANDO_RNA/assemble/final/idba/DNA-all/DNA-all-contig.fa in=/projects/b1052/Wells_b1042/GaoHan/CANDO_RNA/clean_reads/Wells02/filter_reads/RNA-Ac-1_S7_filter.fa out=RNA-Ac-1_S7_filter.test.sam minid=0.95 ambig=random reads=100000 -Xmx100g -eoom
java -Djava.library.path=/home/hgx080/bbmap/jni/ -ea -Xmx100g -cp /home/hgx080/bbmap/current/ align2.BBMap build=1 overwrite=true fastareadlen=500 ref=/projects/b1052/Wells_b1042/GaoHan/CANDO_RNA/assemble/final/idba/DNA-all/DNA-all-contig.fa in=/projects/b1052/Wells_b1042/GaoHan/CANDO_RNA/clean_reads/Wells02/filter_reads/RNA-Ac-1_S7_filter.fa out=RNA-Ac-1_S7_filter.test.sam minid=0.95 ambig=random reads=100000 -Xmx100g -eoom
Executing align2.BBMap [build=1, overwrite=true, fastareadlen=500, ref=/projects/b1052/Wells_b1042/GaoHan/CANDO_RNA/assemble/final/idba/DNA-all/DNA-all-contig.fa, in=/projects/b1052/Wells_b1042/GaoHan/CANDO_RNA/clean_reads/Wells02/filter_reads/RNA-Ac-1_S7_filter.fa, out=RNA-Ac-1_S7_filter.test.sam, minid=0.95, ambig=random, reads=100000, -Xmx100g, -eoom]
Version 38.11
Choosing a site randomly for ambiguous mappings.
Set MINIMUM_ALIGNMENT_SCORE_RATIO to 0.908
NOTE: Ignoring reference file because it already appears to have been processed.
NOTE: If you wish to regenerate the index, please manually delete ref/genome/1/summary.txt
Max reads: 100000
Set genome to 1
Exception in thread "Thread-0" java.lang.RuntimeException: java.lang.RuntimeException: java.io.EOFException: Unexpected end of ZLIB input stream
at align2.ChromLoadThread.run(ChromLoadThread.java:79)
Caused by: java.lang.RuntimeException: java.io.EOFException: Unexpected end of ZLIB input stream
at fileIO.ReadWrite.readObject(ReadWrite.java:806)
at fileIO.ReadWrite.read(ReadWrite.java:1246)
at dna.ChromosomeArray.read(ChromosomeArray.java:65)
at align2.ChromLoadThread.run(ChromLoadThread.java:76)
Caused by: java.io.EOFException: Unexpected end of ZLIB input stream
at java.util.zip.InflaterInputStream.fill(InflaterInputStream.java:240)
at java.util.zip.InflaterInputStream.read(InflaterInputStream.java:158)
at java.util.zip.GZIPInputStream.read(GZIPInputStream.java:117)
at java.io.ObjectInputStream$PeekInputStream.read(ObjectInputStream.java:2620)
at java.io.ObjectInputStream$BlockDataInputStream.read(ObjectInputStream.java:3031)
at java.io.ObjectInputStream$BlockDataInputStream.readFully(ObjectInputStream.java:3061)
at java.io.ObjectInputStream.readArray(ObjectInputStream.java:1914)
at java.io.ObjectInputStream.readObject0(ObjectInputStream.java:1529)
at java.io.ObjectInputStream.defaultReadFields(ObjectInputStream.java:2245)
at java.io.ObjectInputStream.readSerialData(ObjectInputStream.java:2169)
at java.io.ObjectInputStream.readOrdinaryObject(ObjectInputStream.java:2027)
at java.io.ObjectInputStream.readObject0(ObjectInputStream.java:1535)
at java.io.ObjectInputStream.readObject(ObjectInputStream.java:422)
at fileIO.ReadWrite.readObject(ReadWrite.java:802)
... 3 more
Comment
-
-
Hello! Thanks for all of the wonderful bbmap scripts. Today I was was trying to use bbfakereads.sh but the script can not locate or open the jgi/FakeReads file. Any thoughts? I noticed a Fakereads files in the current/jgi directory. Do you think the path in the script is incorrect?
Thanks for your time and help!
bbfakereads.sh in=scaffolds.fasta out=fakePE_R1.fasta out2=fakePE.R2.fasta length=150
java -ea -Xmx600m -cp /media/bioinformaticprograms/BBMap/sh/current/ jgi.FakeReads in=scaffolds.fasta out=fakePE_R1.fasta out2=fakePE.R2.fasta length=150
Error: Could not find or load main class jgi.FakeReads
Comment
-
-
You're right. It wasn't downloaded correctly. At first I used git to download the bbmap package. But when I just downloaded with wget from https://sourceforge.net/projects/bbm...p_38.12.tar.gz everything was organized correctly.
Thanks for the help.
Comment
-
-
Add hg19 masked reference to distribution
Hello,
I'm using BBTools via bioconda and the corresponding quay.io docker container. The image has the necessary resources, e.g. the adapters fasta file:
However, the removehuman.sh script uses a hardcoded path for the masked human genome posted in the RemoveHuman thread.Code:(base) Wed 25 Jul - 17:10 ~/code/tick-genome/reflow origin ☊ master 9☀ 1● docker run -it -v $PWD:/data quay.io/biocontainers/bbmap:38.06--2 bash bash-4.2# find . -name adapters.fa ./usr/local/opt/bbmap-38.06/resources/adapters.fa bash-4.2# cd ./usr/local/opt/bbmap-38.06/resources bash-4.2# ll bash: ll: command not found bash-4.2# ls adapters.fa blacklist_silva_species_500.sketch lambda.fa.gz nextera_LMP_linker.fa.gz primes.txt.gz sequencing_artifacts.fa.gz adapters_no_transposase.fa.gz contents.txt lfpe.linker.fa.gz pJET1.2.fa remote_files.txt short.fa blacklist_img_species_300.sketch crelox.fa.gz mtst.fa phix174_ill.ref.fa.gz remote_files_old.txt truseq.fa.gz blacklist_nt_species_1000.sketch favicon.ico nextera.fa.gz phix_adapters.fa.gz sample1.fq.gz truseq_rna.fa.gz blacklist_refseq_species_250.sketch kapatags.L40.fa nextera_LMP_adapter.fa.gz polyA.fa.gz sample2.fq.gz
Can the masked genome be included in the distribution?Code:local CMD="java -Djava.library.path=$NATIVELIBDIR $EA $z -cp $CP align2.BBMap minratio=0.9 maxindel=3 bwr=0.16 bw=12 quickmatch fast minhits=2 path=/global/projectb/sandbox/gaag/bbtools/hg19 pigz unpigz zl=6 qtrim=r trimq=10 untrim idtag usemodulo printunmappedcount usejni ztd=2 kfilter=25 maxsites=1 k=14 $@
Thank you!
Warmest,
Olga
Comment
-
-
Hello Brian,
After running mapPacBio.sh, how can I combine the sequence of the same ID?
for example I want to combine the sequences as following:
m151006_234406_42219_c100867912550000001823195203031665_s1_p0/110457/57769_70466 id=3_0_part_2_6
m151006_234406_42219_c100867912550000001823195203031665_s1_p0/110457/57769_70466 id=3_0_part_3
Thanks,
Fuyou
Comment
-
-
pull out sequences with matching primers
Hi Brian,
I was wondering if bbmap has a tool that will pull out reads matching a particular primer sequences? I have fastq files with amplicons from 12 different primers in the same file so i want to make subsets of the reads having specific primers of interest from this.
i have used your tool for other tasks so i figured I would ask if it also has this capability?
Thank you,
Jen
Comment
-
-
-
Hi,
Hoping somebody can help me with this.
I used BBMap and now I would like to extract the reads from by .bam file that are split (/chimeric?) ie. reads that indicate a deletion.
I tried to use samblaster, but it doesn't recognize any reads as split...
(samtools view -h in.bam | samblaster -a -s split.sam -o /dev/null)
Are the split reads marked differently in BBMap compared to other aligners causing samblaster to fail?
IGV shows a good amount of reads with deletions and I can also call deletions using BBTools callvariants.sh - so I know they are in there. I just have a feeling callvariants is calling fewer deletions and with lower coverage than what IGV suggests, so I want to check up on it.
Comment
-
-
mkf argument in bbduk.sh (bbmap tool)
Hello,
I am trying to use the flag mkf (minkmerfraction) and I am getting an error that that argument does not exist.
sh /data/barbj/bbmap/bbduk.sh in=./../Stool_001-01.fastq outm=v2fstoolfq.fa literal=CTCAAACTTGGGTAATTAAACC k=17 mkf=0.8
java -Djava.library.path=/data/barbj/bbmap/jni/ -ea -Xmx39767m -Xms39767m -cp /data/barbj/bbmap/current/ jgi.BBDukF in=./../Stool_001-01.fastq outm=v2fstoolfq.fa literal=CTCAAACTTGGGTAATTAAACC k=17 mkf=0.8
Executing jgi.BBDukF [in=./../Stool_001-01.fastq, outm=v2fstoolfq.fa, literal=CTCAAACTTGGGTAATTAAACC, k=17, mkf=0.8]
Exception in thread "main" java.lang.RuntimeException: Unknown parameter mkf=0.8
at jgi.BBDukF.<init>(BBDukF.java:402)
any ideas why this is not working?
Jen
Comment
-
Latest Articles
Collapse
-
by SEQadmin2
Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
...-
Channel: Articles
07-09-2026, 11:10 AM -
-
by SEQadmin2
Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.
There is no single reason why many patients don’t respond to treatment as expected. Cancer is...-
Channel: Articles
07-08-2026, 05:17 AM -
-
by GATTACATLove this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
-
Channel: Articles
07-01-2026, 11:43 AM -
ad_right_rmr
Collapse
News
Collapse
| Topics | Statistics | Last Post | ||
|---|---|---|---|---|
|
Started by SEQadmin2, Yesterday, 10:26 AM
|
0 responses
11 views
0 reactions
|
Last Post
by SEQadmin2
Yesterday, 10:26 AM
|
||
|
Started by SEQadmin2, 07-09-2026, 10:04 AM
|
0 responses
25 views
0 reactions
|
Last Post
by SEQadmin2
07-09-2026, 10:04 AM
|
||
|
Started by SEQadmin2, 07-08-2026, 10:08 AM
|
0 responses
16 views
0 reactions
|
Last Post
by SEQadmin2
07-08-2026, 10:08 AM
|
||
|
Started by SEQadmin2, 07-07-2026, 11:05 AM
|
0 responses
33 views
0 reactions
|
Last Post
by SEQadmin2
07-07-2026, 11:05 AM
|
Comment