Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • horvathdp
    Member
    • Dec 2011
    • 66

    Why is BBmap throwing java error

    Hi all,

    I have some myseq data that I want to clean up using bbmap. When I give the following command, I get this error. What is wrong? I am guessing it is having a problem with the sequence I downloaded from the vendor, but I can't figure out what the issue is. Help???

    ./bbduk.sh in1=Plate1_clean1_R1.fastq in2=Plate1_clean1_R2.fastq out1=Plate1_clean2_R1.fastq out2=Plate1_clean2_R2.fastq qtrim=rl trimq=20 minlen=70

    java -Djava.library.path=/home/dave/bbmap/jni/ -ea -Xmx103643m -Xms103643m -cp /home/dave/bbmap/current/ jgi.BBDukF in1=Plate1_clean1_R1.fastq in2=Plate1_clean1_R2.fastq out1=Plate1_clean2_R1.fastq out2=Plate1_clean2_R2.fastq qtrim=rl trimq=20 minlen=70
    Executing jgi.BBDukF [in1=Plate1_clean1_R1.fastq, in2=Plate1_clean1_R2.fastq, out1=Plate1_clean2_R1.fastq, out2=Plate1_clean2_R2.fastq, qtrim=rl, trimq=20, minlen=70]

    BBDuk version 35.82
    Initial:
    Memory: max=104150m, free=100346m, used=3804m

    Input is being processed as paired
    Started output streams: 0.025 seconds.
    Exception in thread "Thread-5" java.lang.AssertionError:
    Error in Plate1_clean1_R1.fastq, line 1046, with these 4 lines:
    GTTCGTCTCTACACTGACGACATGGTTCTACAGTCCATGTGAATACGAAGGGAAGCATTTTTTTTAAAAAGTAAATTGTTTTGTATACTGCAGTACTATGGGCTATGGTGAGACCAAGTCTCTGCTACCGTATGCGTCAGAAGATCGGAAT
    +
    >1>>1>AAFFDFEGGDAGEAEEE1FGHHHHHHHHHHHHHHHFHHHHHGCFGCF0E/1DFGHHGGGE1@G1AGHHHHHHHGHGEHBGHHHHHFFHHFHFG2BFFHHHHHF1101>?CFHHHHHFH1EG1FCFHHGH?EC/?11<CGHHG///
    @M00619:318:000000000-B4H7N:1:1101:17348:2448 1:N:0:ATCACGAT+TCTTTCCC

    at stream.FASTQ.quadToRead(FASTQ.java:722)
    at stream.FASTQ.toReadList(FASTQ.java:653)
    at stream.FastqReadInputStream.fillBuffer(FastqReadInputStream.java:111)
    at stream.FastqReadInputStream.hasMore(FastqReadInputStream.java:76)
    at stream.ConcurrentGenericReadInputStream$ReadThread.readLists(ConcurrentGenericReadInputStream.java:643)
    at stream.ConcurrentGenericReadInputStream$ReadThread.run(ConcurrentGenericReadInputStream.java:635)
    Exception in thread "Thread-6" java.lang.AssertionError:
    Error in Plate1_clean1_R2.fastq, line 1145, with these 4 lines:
    TCACGCTATGTACGGTAGCAGAGACTTGGTCTGGTTGCTTATTGGGTTACGGTTTGATTGTTGATTCGTGGTGGTACAACTTTAGTGACGGATGGTGATTGTTGTGATGGTAAGCTAAGGTCGTGTAGAACCATGTCGTCAGTGTCATAGC
    +
    1>>>AFAA?FFBGGCGGGFFGGHFBGHH1GGHHFDGGHFHHGHFFHFFGACFF/EEBDGFFDGFGHFEHEFACEEHHEHFFHH@GG12FFE/>E/F1@2GF@DGHF2221F2B>1B1B1FGHEE/?F12EDHAGEDGAFF//BBF2>FFF1
    @M00619:318:000000000-B4H7N:1:1101:14067:2496 2:N:0:ATCACGAT+TCTTTCCC

    at stream.FASTQ.quadToRead(FASTQ.java:722)
    at stream.FASTQ.toReadList(FASTQ.java:653)
    at stream.FastqReadInputStream.fillBuffer(FastqReadInputStream.java:111)
    at stream.FastqReadInputStream.hasMore(FastqReadInputStream.java:76)
    at stream.ConcurrentGenericReadInputStream$ReadThread.readLists(ConcurrentGenericReadInputStream.java:643)
    at stream.ConcurrentGenericReadInputStream$ReadThread.run(ConcurrentGenericReadInputStream.java:635)
  • GenoMax
    Senior Member
    • Feb 2008
    • 7142

    #2
    Can you try running by specifying the memory by adding "-Xmx4g" to your command?

    Comment

    Latest Articles

    Collapse

    • SEQadmin2
      Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
      by SEQadmin2



      Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
      ...
      07-09-2026, 11:10 AM
    • SEQadmin2
      Cancer Drug Resistance: The Lingering Barrier to Rising Survival
      by SEQadmin2



      Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

      There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
      07-08-2026, 05:17 AM
    • GATTACAT
      Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
      by GATTACAT
      Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
      07-01-2026, 11:43 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by SEQadmin2, 07-13-2026, 10:26 AM
    0 responses
    20 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-09-2026, 10:04 AM
    0 responses
    31 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-08-2026, 10:08 AM
    0 responses
    20 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-07-2026, 11:05 AM
    0 responses
    34 views
    0 reactions
    Last Post SEQadmin2  
    Working...