Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • kmcarr
    Senior Member
    • May 2008
    • 1181

    #16
    Originally posted by proteasome
    Debabrata:

    For current "Titanium" reagents the adapter sequences are:

    A: CGTATCGCCTCCCTCGCGCCATCAG
    B: CTATGCGCCTTGCCAGCCCGCTCAG


    Simon
    Originally posted by pmiguel View Post
    Simon,

    Where did you get these? They do not the match the Lib-L Titanium adaptor sequences I have seen.

    Phillip
    These are the Amplicon primer sequences. If you use these sequences you would need to use the Lib-A emulsion kit

    Comment

    • naxin
      Junior Member
      • Jul 2010
      • 6

      #17
      Originally posted by tplsmith View Post
      There is clearly a reagent problem with emPCR reagents of late. Even libraries that we have previously run do not perform well using recent lots of SV emPCR reagents. This is less true of LV emPCR but it has also been somewhat problem. I understand from our Roche rep that they are undertaking a "reformulation" of the SV kits right now and have already done so for the LV emPCR kits, that is supposed to reduce the inter-kit variability in success.

      On another thread I have seen reports that the problem is even worse for Lib-A kits than Lib-L.
      Do you mean the emPCR kit with the new emulsion Oil? I run two emPCR, and 3 out of 4 cups have problem.

      Comment

      • rmprieto
        Junior Member
        • Aug 2010
        • 1

        #18
        We have been doing some Lib-A SV experiments recently, and we have a similar problem: in spite of increasing the amount of template, the enrichment percentage remains poor. Do you have any information regarding the kit numbers that are defective? Maybe we are facing the same problem than you have found.

        Comment

        • RCJK
          Senior Member
          • May 2009
          • 156

          #19
          Has anyone had issues lately with broken emulsions, specifically with MV and/or LV? I've not had this issue until a few weeks ago. The lots of oil involved were MV: 93750020 & 93766120, LV: 93771120. The emulsions do not look completely broken, but many of the wells have a bead pellet at the bottom, with a clear layer, and then a white layer above that. I've repeated the same samples across two lots of MV oils and have had the same thing. The LV reactions were a different set of libraries (one Lib-A and one Lib-L) and also showed the same. Roche is being rather quiet about this and not offering any other suggestions to me other than possibly sending a new kit to try it again.

          Comment

          • gallus
            Junior Member
            • Aug 2010
            • 4

            #20
            we've been having problems with SV lots (93768220 and 93776220). they look like the emPCR is the issue though no obvious broken reactors. the attached 1/8 Ti bacterial genomic was deemed "good" by the Roche engineer we talked to (though i disagree). we've sequenced the same type of sample/prep from this PI with lot 9378740 and beautiful distribution with avg of 500 bp. now, hardly any reads above 400 bp with a very odd peak at 120 bp. we've submitted RunReports etc to support with only the normal "we've received your message" response. any others have this lot (especially *8220)?
            Attached Files

            Comment

            • Soulbee
              Member
              • Jun 2010
              • 25

              #21
              i'm using LV lot # 93799720 which has not given me any problems, and neither has the MV (but not sure what the Lot number is for the MV oil, sorry!)

              Comment

              • Christina85
                Junior Member
                • Aug 2011
                • 7

                #22
                Hi!

                Can you think of an explanation for very high enrichment values (40% to even 70%)?

                I have posted the details on "Calculation of % Bead enrichment (454 FLX Titanium)": http://seqanswers.com/forums/showthread.php?t=18588

                Thank you!!

                Comment

                Latest Articles

                Collapse

                • SEQadmin2
                  Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                  by SEQadmin2


                  Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                  The systematic characterization of the human proteome has
                  ...
                  07-20-2026, 11:48 AM
                • SEQadmin2
                  Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                  by SEQadmin2



                  Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                  ...
                  07-09-2026, 11:10 AM
                • SEQadmin2
                  Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                  by SEQadmin2



                  Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                  There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                  07-08-2026, 05:17 AM

                ad_right_rmr

                Collapse

                News

                Collapse

                Topics Statistics Last Post
                Started by SEQadmin2, 07-20-2026, 11:10 AM
                0 responses
                12 views
                0 reactions
                Last Post SEQadmin2  
                Started by SEQadmin2, 07-13-2026, 10:26 AM
                0 responses
                30 views
                0 reactions
                Last Post SEQadmin2  
                Started by SEQadmin2, 07-09-2026, 10:04 AM
                0 responses
                41 views
                0 reactions
                Last Post SEQadmin2  
                Started by SEQadmin2, 07-08-2026, 10:08 AM
                0 responses
                26 views
                0 reactions
                Last Post SEQadmin2  
                Working...