Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • AdamB
    Member
    • Apr 2010
    • 43

    #1

    FindPeaks SeparateReads.jar error using GERALD/ELAND-generated files

    I'm trying to use FindPeaks with some data mapped in ELAND via GERALD. At the moment I'm stuck on using SeparateReads.jar. Below is a sample of the data from the input "s_X_sorted.txt" file:

    Code:
    HWI-EAS486	19	4	26	19288	17610	0	1	GCTTGTGTATCACTGGCGCAGCAGAGAGTCTGAGCATG	hhhhhhhhhghhhhhhfhfhcgdggcffchggfghfgh	chr10.fa		55	F	38131					
    HWI-EAS486	19	4	65	12362	19698	0	1	CTGGTTAGAACAGCTAGGCCCTTGGGCCTCACTGTACA	hhhhhhghhhhhhhhhghhhhhhhhgfhhhhhhhfhhh	chr10.fa		145	F	38131					
    HWI-EAS486	19	4	79	19730	5608	0	1	GCCAGCCTGGCAACTATCAGGCCACAAGGTGACATAAG	gggggggggdffc_fggggfc]ffWfcfadffffea_[	chr10.fa		309	F	19T18	88
    I read in another thread that I could specify the aligner as "elandext", but to no avail. I get the following error message from SeparateReads.jar:

    Code:
    Version: Initializing class Log_Buffer                        $Revision: 2530 $
    Version: Vancouver Short Read Analysis Package                4.0.16-dev.jars
    Version: Initializing class SeparateReads                     $Revision: 3125 $
    Version: Initializing class Generic_AlignRead_Iterator        $Revision: 3118 $
    Version: Initializing class ElandExtIterator                  $Revision: 2933 $
    Exception in thread "main" java.lang.StringIndexOutOfBoundsException: String index out of range: 38
    	at java.lang.StringBuffer.setCharAt(StringBuffer.java:210)
    	at src.lib.ioInterfaces.ElandExtUtilities.parse_mismatches(ElandExtUtilities.java:23)
    	at src.lib.ioInterfaces.ElandExtIterator.next(ElandExtIterator.java:213)
    	at src.lib.ioInterfaces.ElandExtIterator.next(ElandExtIterator.java:22)
    	at src.lib.ioInterfaces.Generic_AlignRead_Iterator.hasNext(Generic_AlignRead_Iterator.java:121)
    	at src.fileUtilities.SeparateReads.main(SeparateReads.java:70)
    Is this a problem with the input file? I can't find any specification for the eland/elandext inputs for FindPeaks anywhere.
  • apfejes
    Senior Member
    • Feb 2008
    • 236

    #2
    Hi Adam,

    This may be a little more technically challenging, but would you be willing to compile and run from source? I suspect that this problem has been solved in the latest version, which has not yet been released.

    I can help walk you through the process, if you're unsure how to do that. If not, I can email you a compiled version.

    Anthony
    The more you know, the more you know you don't know. —Aristotle

    Comment

    • AdamB
      Member
      • Apr 2010
      • 43

      #3
      Hi Anthony,

      Yes I'd definitely like to try compiling the latest version. Is it on the website?

      Thanks

      Comment

      • apfejes
        Senior Member
        • Feb 2008
        • 236

        #4
        It's available from the svn repository. There are instructions here: http://sourceforge.net/apps/mediawik...=VSRAPBuilding

        use svn to get a copy of the source, and ant to build it (once you have ant and subversion installed)

        The more you know, the more you know you don't know. —Aristotle

        Comment

        • AdamB
          Member
          • Apr 2010
          • 43

          #5
          I can confirm the latest version (4.0.17) successfully separated my reads using the "elandext" flag.

          Thanks for your help.

          Comment

          • apfejes
            Senior Member
            • Feb 2008
            • 236

            #6
            Great, glad it's working!

            Anthony
            The more you know, the more you know you don't know. —Aristotle

            Comment

            • AdamB
              Member
              • Apr 2010
              • 43

              #7
              Small update: I tried to generate a wig file, which worked apart from that the chromosome name in the header was "chr1.fa". UCSC did not like this, so I changed the chromosome name to "chr1", and then it loaded okay. Do you know where the ".fa" part is coming from, and if it can be changed?

              Thanks.

              Comment

              • apfejes
                Senior Member
                • Feb 2008
                • 236

                #8
                That's coming directly from your file - the aligner is using the name of the file as the chromosome. (You can even see it in the snippet you gave at the top of the thread for chr10.fa)

                I seem to recall that there was a flag in FindPeaks to trim chromosome names and remove the .fa, but it escapes me what it would be. In the end, I think we just renamed all our .fa files to remove the extension and not have to worry about post processing our eland files.
                The more you know, the more you know you don't know. —Aristotle

                Comment

                Latest Articles

                Collapse

                • SEQadmin2
                  Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                  by SEQadmin2



                  CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                  Despite this, “CRISPR helped turn genome editing from a specialized technique into
                  ...
                  07-31-2026, 11:01 AM
                • SEQadmin2
                  Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                  by SEQadmin2


                  Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                  The systematic characterization of the human proteome has
                  ...
                  07-20-2026, 11:48 AM

                ad_right_rmr

                Collapse

                News

                Collapse

                Topics Statistics Last Post
                Started by SEQadmin2, 08-06-2026, 07:41 AM
                0 responses
                23 views
                0 reactions
                Last Post SEQadmin2  
                Started by SEQadmin2, 08-03-2026, 10:13 AM
                0 responses
                40 views
                0 reactions
                Last Post SEQadmin2  
                Started by SEQadmin2, 07-31-2026, 02:55 AM
                0 responses
                45 views
                0 reactions
                Last Post SEQadmin2  
                Started by SEQadmin2, 07-24-2026, 12:17 PM
                0 responses
                29 views
                0 reactions
                Last Post SEQadmin2  
                Working...