SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics

Similar Threads
Thread Thread Starter Forum Replies Last Post
SNP quality score in Samtools pileup wangzkai Bioinformatics 5 09-21-2011 06:32 AM
samtools pileup base quality swapna Genomic Resequencing 0 02-23-2011 03:36 AM
Samtools pileup indel quality score computation christophpale Bioinformatics 0 07-27-2010 12:51 PM
How is SNP quality calculated in SAMTOOLS pileup? lazyworm Bioinformatics 2 05-28-2010 12:00 AM
get read position from Samtools pileup rcorbett Bioinformatics 2 02-10-2010 03:38 PM

Reply
 
Thread Tools
Old 11-19-2010, 06:55 AM   #1
DNAjunk
Member
 
Location: Western Europe

Join Date: Jun 2009
Posts: 58
Default samtools pileup c-option changes read quality

Hi

I might be wrong but I got the impression that when using the c-option in the pileup process, then the read qualities are changed (near an indel, N's are placed also):
(I am using version 0.1.9 but version 0.1.10 seems to be the same). I am sure that there is an explanation, but I dont know it! Thanks for help!

Example: the differences are lines 68-71

with c option: (jump to line 67-75)
/apps/bi/samtools/c/samtools pileup -c test.bam -f test_ref.fa | less
test 67 A A 30 0 60 1 . 1
test 68 C N 0 0 0 1 . (
test 69 C N 0 0 0 1 . %
test 70 C N 0 0 0 1 . !
test 71 C N 0 0 0 1 .-1C !
test 71 * -C/-C 40 0 60 1 -C * 1 0 0 0 0
test 72 C N 0 0 0 1 * <
test 73 T T 30 0 60 1 . <
test 74 A A 30 0 60 1 . @
test 75 T T 30 0 60 1 . 1


without c option: (jump to line 67-75)
/apps/bi/samtools/c/samtools pileup test.bam -f test_ref.fa | less
test 67 A 1 . 1
test 68 C 1 . 1
test 69 C 1 . 1
test 70 C 1 . 1
test 71 C 1 .-1C 1
test 72 C 1 * <
test 73 T 1 . <
test 74 A 1 . @
test 75 T 1 . 1

Here is my test.sam file

@HD VN:0.0 GO:none SO:coordinate
@SQ SN:test LN:360
@PG ID:map2sam
GLXM4QB02GKAEH 0 test 1 255 71M1D17M1D20M1I147M * 0 0 GATCTCTTTTTCCAGTTTAAAAGTTCAGCTATTACAAGGTAAATGCAAAATGACAGTAAGGTTCCCACCCCTATTTTTCATCTTTTATGTCAAGAAGATACTTGTAAAAGAGAAGTAAGGTTAGGTATGATATTCGTTTATAAAGCATTTGGTGGAATACAGCGGTGGCAGGAAGTTGAACTGTCAACATTTTTGACCGTGTCAATTCATTTAATACATGTAGCCTGTATCTATTGAGTATATGGTACACATGCGG BAAABB55733>><94444444=99??>??<888?<<<89333=996666ABA???CDBAAAA<<;11111<@11100=?A?44444/4894443<98===993/.,,,-,559531266><866669:<<32444339@9;;<BBB???::8AAAA???DDDDDBBA?>===83../..33:8:9921,,,,,..--558875555:3...222679::9:32449898<<<<=AAAA@@<84449:666<::--


Here is the test_ref.fa file

>test
GATCTCTTTTTCCAGTTTAAAAGTTCAGCTATTACAAGGTAAATGCAAAATGACAGTAAG
GTTCCCACCCCCTATTTTTCATCTTTTATTGTCAAGAAGATACTTGCAAAGAGAAGTAAG
GTTAGGTATGATATTCGTTTATAAAGCATTTGGTGGAATACAGCGGTGGCAGGAAGTTGA
ACTGTCAACATTTTGTACCGTGTCAATTCATTTAATACATGTAGCCTGTATCTATTGAGT
ATATGGTACACATGCGGAAGTGTTCTGAGGATAAAGTCACGAAAAAAAAAAGGCACAATT
CTTGTTTTCAGGGAGATTATGTTCTAGTGAGGAGAATAATAGAAGAAGAAAGTCCCACTC
DNAjunk is offline   Reply With Quote
Old 08-01-2011, 01:24 AM   #2
Cynthia3.14
Junior Member
 
Location: Amsterdam

Join Date: Jul 2011
Posts: 1
Default base quality score changes option -c samtools pileup and mpileup

Hi,

I can confirm this bug, as I had also noticed base quality scores changes with -c option, when I compared the number of high quality en low quality bases of a first mapping to a remapping against a sample specific reference. It appeared that low quality (LQ) bases, in the first mapping turned into high (HQ) quality bases, at positions were initially the reads did not match the reference and did in the remapping. So, I checked this problem with 10 reads at positions where a mutation occurred:

first mapping
ref HQ_A HQ_C HQ_G HQ_T LQ_A LQ_C LQ_G LQ_T
T 0 2 0 1 0 7 0 0
second mapping
ref HQ_A HQ_C HQ_G HQ_T LQ_A LQ_C LQ_G LQ_T
C 0 9 0 1 0 0 0 0

When the pileup was made without the option -c, these changes did not happen. Also, mpileup seems to have this same problem.
Cynthia3.14 is offline   Reply With Quote
Reply

Tags
pileup, samtools

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 03:26 PM.


Powered by vBulletin® Version 3.8.6
Copyright ©2000 - 2014, Jelsoft Enterprises Ltd.