s_#_sorted.txt to BED

apche93 · 02-07-2012, 12:14 PM

Hi all,

I am trying to convert the following type of code into bed format or really anything that I can view in IGV or IGB browsers. I think it is in eland sorted format, but not too sure.

Code:

HWI-EAS240      FC2087UAAXX     3       257     951     322                     TGTTGTCTCTCTTCTGGGTCTAGCCACCTAGCAAGT    [[[[[[[[[[[[[[[ZZU[[[[U[[Z[[X[VSSOVS    chr10.fasta             53590   R       33G2    0

I looked around and found that I might be able to use SAMTOOLS or FINDPEAKS. This is probably a simple conversion, but I'm not too familiar with the implementation of these programs so I'd really appreciate any help.

Thanks in advance!

Similar Threads
Thread	Thread Starter	Forum	Replies	Last Post
How to convert .txt file to .bed or .gff, How can we use chip seq data in R software	forevermark4	Bioinformatics	56	01-19-2012 08:26 AM
Is there a tool that converts TXT, BED, GFF format to VCF?	LauraSmith	Bioinformatics	3	12-05-2011 11:32 AM
Is it possible to convert a SNP.txt to a bed file or get a SNP.bed from samtools?	Ling	Bioinformatics	3	02-06-2010 06:33 PM
How to transform BAM format to .TXT or .BED?	zhenshao	Bioinformatics	3	01-11-2010 10:31 AM
s_#_sorted.txt files	caza	Bioinformatics	2	04-28-2009 08:12 AM

02-07-2012, 12:14 PM	#1
apche93 Junior Member Location: united states Join Date: Feb 2012 Posts: 1	s_#_sorted.txt to BED Hi all, I am trying to convert the following type of code into bed format or really anything that I can view in IGV or IGB browsers. I think it is in eland sorted format, but not too sure. Code: HWI-EAS240 FC2087UAAXX 3 257 951 322 TGTTGTCTCTCTTCTGGGTCTAGCCACCTAGCAAGT [[[[[[[[[[[[[[[ZZU[[[[U[[Z[[X[VSSOVS chr10.fasta 53590 R 33G2 0 I looked around and found that I might be able to use SAMTOOLS or FINDPEAKS. This is probably a simple conversion, but I'm not too familiar with the implementation of these programs so I'd really appreciate any help. Thanks in advance!