Unconfigured Ad

Collapse
X
Collapse
 
  • Page of 1
  • Filter
  • Time
  • Show
Clear All
new posts
Previous template Next
  • apche93
    Junior Member
    • Feb 2012
    • 1
    #1

    s_#_sorted.txt to BED

    Hi all,

    I am trying to convert the following type of code into bed format or really anything that I can view in IGV or IGB browsers. I think it is in eland sorted format, but not too sure.

    Code:
    HWI-EAS240      FC2087UAAXX     3       257     951     322                     TGTTGTCTCTCTTCTGGGTCTAGCCACCTAGCAAGT    [[[[[[[[[[[[[[[ZZU[[[[U[[Z[[X[VSSOVS    chr10.fasta             53590   R       33G2    0

    I looked around and found that I might be able to use SAMTOOLS or FINDPEAKS. This is probably a simple conversion, but I'm not too familiar with the implementation of these programs so I'd really appreciate any help.

    Thanks in advance!
    Tags: bed, conversion, eland sorted, sorted.txt
Previous template Next

Latest Articles

Collapse
  • GATTACAT
    Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
    by GATTACAT
    Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
    Yesterday, 11:43 AM
  • SEQadmin2
    Nine Things a Sample Prep Scientist Thinks About Before Sequencing
    by SEQadmin2


    I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.

    Here are nine questions we think about, in roughly the order they matter, before...
    06-18-2026, 07:11 AM
View All

ad_right_rmr

Collapse

News

Collapse
Topics Statistics Last Post
High-Resolution Sequencing Exposes Hidden Toxoplasma Diversity by SEQadmin2
Started by SEQadmin2, Today, 11:08 AM
0 responses
6 views
0 reactions
 Last Post SEQadmin2
by SEQadmin2
Today, 11:08 AM  
New AI Model Captures Long-Range Genomic Signals to Improve RNA Splice Site Prediction by SEQadmin2
Started by SEQadmin2, 06-30-2026, 05:37 AM
0 responses
11 views
0 reactions
 Last Post SEQadmin2
by SEQadmin2
06-30-2026, 05:37 AM  
Large-Scale Protein Screen Uncovers Hidden Regulators of Alternative Polyadenylation by SEQadmin2
Started by SEQadmin2, 06-26-2026, 11:10 AM
0 responses
18 views
0 reactions
 Last Post SEQadmin2
by SEQadmin2
06-26-2026, 11:10 AM  
Whole-Genome Sequencing Traces Faroe Islands Ancestry to a North Atlantic Founder Population by SEQadmin2
Started by SEQadmin2, 06-17-2026, 06:09 AM
0 responses
52 views
0 reactions
 Last Post SEQadmin2
by SEQadmin2
06-17-2026, 06:09 AM  
View All
Working...