[Cole Trapnell]

Tophat doesn't look like it will work for me so I put together a plan to do it another way using bowtie. Then I found out that on my mac pro, I am getting an alignment speed of approximately 60 reads/hour. That's significantly less than the 25,000,000/hour that I expected. This run of one sequence against the m_musculus index that I downloaded from the bowtie site takes about 45 seconds. Here's the command I used. Any idea why it would take so long? I rebooted to make sure there was nothing else taxing the resources.

bowtie -c /Applications/bowtie-0.10.0/indexes/m_musculus GAAAGTCATGCGTTTCAAGTTTGGCAAGGAATAGAAACAGACGGGCTTATGAAAATAAGGAAAACATCACCCCCAGGCG

That sequence should have no spaces, I don't know why the forum inserts a space in the middle of it...

Thanks in advance for any suggestions.

Wait, that's only one read. Are you aligning all of them that way, individually on the command line?

[greggrant]

Wait, that's only one read. Are you aligning all of them that way, individually on the command line?

No I wasn't, but I think I figured it out, it takes a long time to get up and running, but once it does then it moves fast. So speed can best be tested by comparing the time between N and M reads, to subtract for start-up time. Thanks for responding so quickly.

[greggrant]

Bowtie works great, it's incredible that illumina's bundled aligner is still so poor. But is it possible to use bowtie to map also to the transcriptome? Or is that best done another way? Thanks for your help!

[acpatel]

454 support?

Trimming all of the sequences to the same length seems like a bad idea. Any idea when tophat / bowtie will support 454 variable length reads?

Greg -- how did you take your mouse reads and get them to be a uniform length? Straight trimming? Segmenting?

Thanks,
Anand

[Cole Trapnell]

Bowtie already supports variable length reads. It's TopHat that has a problem with them. Fixing TopHat for 454 would require more work than I have time to do in the near future, as I am focused primarily on Cufflinks (and graduating). It's on the list of things to do, but so are many other things...

One obstacle to me making the changes is that I don't currently have any 454 RNA-Seq data to work with, as none of my collaborators use it. If someone was willing to provide me with a small test set (perhaps a chromosome's worth), I could at least assess how much work it will actually be to add support for this. I'd keep it confidential, of course.

[acpatel]

how much data?

Cole,

How much data is a "chromosome's worth"? (I ask only because some chromosomes are huge, and others not so huge).

I've got 9 reads, 312-385 average read length, 110-170 mbases per read.

How much of that would you like? Fastq? SFF?

Thanks,
Anand

[greggrant]

Tophat Coverage Plots

I have a question regarding the coverage files output by tophat. What exactly is required for a read to be include in a coverage map? If Tophat breaks up a read into four pieces and only one maps, is that piece included? Also, how are reads that map to multiple locations handled? Any information is greatly appreciated, thank you.

[greggrant]

I have a question regarding the coverage files output by tophat. What exactly is required for a read to be include in a coverage map? If Tophat breaks up a read into four pieces and only one maps, is that piece included? Also, how are reads that map to multiple locations handled? Any information is greatly appreciated, thank you.

Never mind, I figured it out. If a read maps to two locations, Tophat keeps both and includes both in the coverage plot. I think that fact should be documented somewhere in the manual.

[greggrant]

Trimming all of the sequences to the same length seems like a bad idea. Any idea when tophat / bowtie will support 454 variable length reads?

Greg -- how did you take your mouse reads and get them to be a uniform length? Straight trimming? Segmenting?

Thanks,
Anand

Sorry I just saw this post, I realize I'm responding quite late, but I tiled by 454 reads with equal sized tiles. Didn't work though, tophat didn't produce any good results, surely because it has trouble mapping across those homopolymers. I'm off 454 altogether, I'm only working with Solexa data at this point because we're getting 115 base reads from our machine now so Solexa really seems to have superseded 454 at this point. Sell your 454 stock!

[tschauer]

Hi All,

I am getting this error message on Mac OS X 10.5.8

Could you please help me what did I install wrong?

Thanks in advance!



tophat -r 20 test_ref reads_1.fq reads_2.fq

[2012-10-22 16:52:02] Beginning TopHat run (v2.0.5)
-----------------------------------------------
[2012-10-22 16:52:02] Checking for Bowtie
Bowtie version: 2.0.0.7
[2012-10-22 16:52:02] Checking for Samtools
Samtools version: 0.1.18.0
[2012-10-22 16:52:02] Checking for Bowtie index files
[2012-10-22 16:52:02] Checking for reference FASTA file
[2012-10-22 16:52:02] Generating SAM header for test_ref
format: fastq
quality scale: phred33 (default)
[2012-10-22 16:52:02] Preparing reads
[FAILED]
Error running 'prep_reads'
dyld: unknown required load command 0x80000022

[Nextgenanalysis]

HI.. I am a new user of tophat and I have illumina generated RNA seq single end reads of 35ntd length. Here is the error I am getting when I tried to run tophat...

root@ubuntu:~# tophat -g 1 -p 4 -o '/media/bv/My Passport/output' '/home/bv/Desktop/b/bowtie2-2.1.0/index/hg19' '/media/bv/My Passport/Normal/normal.fastq'

[2013-07-02 12:46:03] Beginning TopHat run (v2.0.3)
-----------------------------------------------
[2013-07-02 12:46:03] Checking for Bowtie
Bowtie version: 2.0.0.6
[2013-07-02 12:46:03] Checking for Samtools
Samtools version: 0.1.19.0
[2013-07-02 12:46:03] Checking for Bowtie index files
[2013-07-02 12:46:03] Checking for reference FASTA file
Warning: Could not find FASTA file /home/bv/Desktop/b/bowtie2-2.1.0/index/hg19.fa
[2013-07-02 12:46:03] Reconstituting reference FASTA file from Bowtie index
Executing: /usr/bin/bowtie2-inspect /home/bv/Desktop/b/bowtie2-2.1.0/index/hg19 > /media/bv/My Passport/output/tmp/hg19.fa
[2013-07-02 12:51:29] Generating SAM header for /home/bv/Desktop/b/bowtie2-2.1.0/index/hg19
format: fastq
quality scale: phred33 (default)
[2013-07-02 12:51:40] Preparing reads
left reads: min. length=35, max. length=35, 15669232 kept reads (5155 discarded)
Warning: you have only one segment per read.
If the read length is greater than or equal to 45bp,
we strongly recommend that you decrease --segment-length to about half the read length because TopHat will work better with multiple segments
open: No such file or directory
[main_samview] fail to open "/media/bv/My" for reading.
Warning: junction database is empty!
open: No such file or directory
[main_samview] fail to open "/media/bv/My" for reading.
[2013-07-02 12:54:33] Reporting output tracks
[FAILED]
Error running /usr/bin/tophat_reports --min-anchor 8 --splice-mismatches 0 --min-report-intron 50 --max-report-intron 500000 --min-isoform-fraction 0.15 --output-dir /media/bv/My Passport/output/ --max-multihits 1 --max-seg-multihits 10 --segment-length 25 --segment-mismatches 2 --min-closure-exon 100 --min-closure-intron 50 --max-closure-intron 5000 --min-coverage-intron 50 --max-coverage-intron 20000 --min-segment-intron 50 --max-segment-intron 500000 --max-mismatches 2 --max-insertion-length 3 --max-deletion-length 3 -z gzip -p4 --no-closure-search --no-microexon-search --sam-header /media/bv/My Passport/output/tmp/hg19_genome.bwt.samheader.sam --samtools=/usr/local/bin/samtools --bowtie2-max-penalty 6 --bowtie2-min-penalty 2 --bowtie2-penalty-for-N 1 --bowtie2-read-gap-open 5 --bowtie2-read-gap-cont 3 --bowtie2-ref-gap-open 5 --bowtie2-ref-gap-cont 3 /media/bv/My Passport/output/tmp/hg19.fa /media/bv/My Passport/output/junctions.bed /media/bv/My Passport/output/insertions.bed /media/bv/My Passport/output/deletions.bed /media/bv/My Passport/output/fusions.out /media/bv/My Passport/output/tmp/accepted_hits /media/bv/My Passport/output/tmp/left_kept_reads.bam
Loaded 0 junctions

please help me in learning what has went wrong..

[jp.]

Hi Next
I think you should know what is your read length and insert size. Tophat takes 250 insert size by default.
Now my question is how can we change the default option ?
may someone answer my question posted here: http://seqanswers.com/forums/showthr...098#post112098

HI.. I am a new user of tophat and I have illumina generated RNA seq single end reads of 35ntd length. Here is the error I am getting when I tried to run tophat...

root@ubuntu:~# tophat -g 1 -p 4 -o '/media/bv/My Passport/output' '/home/bv/Desktop/b/bowtie2-2.1.0/index/hg19' '/media/bv/My Passport/Normal/normal.fastq'

[2013-07-02 12:46:03] Beginning TopHat run (v2.0.3)
-----------------------------------------------
[2013-07-02 12:46:03] Checking for Bowtie
Bowtie version: 2.0.0.6
[2013-07-02 12:46:03] Checking for Samtools
Samtools version: 0.1.19.0
[2013-07-02 12:46:03] Checking for Bowtie index files
[2013-07-02 12:46:03] Checking for reference FASTA file
Warning: Could not find FASTA file /home/bv/Desktop/b/bowtie2-2.1.0/index/hg19.fa
[2013-07-02 12:46:03] Reconstituting reference FASTA file from Bowtie index
Executing: /usr/bin/bowtie2-inspect /home/bv/Desktop/b/bowtie2-2.1.0/index/hg19 > /media/bv/My Passport/output/tmp/hg19.fa
[2013-07-02 12:51:29] Generating SAM header for /home/bv/Desktop/b/bowtie2-2.1.0/index/hg19
format: fastq
quality scale: phred33 (default)
[2013-07-02 12:51:40] Preparing reads
left reads: min. length=35, max. length=35, 15669232 kept reads (5155 discarded)
Warning: you have only one segment per read.
If the read length is greater than or equal to 45bp,
we strongly recommend that you decrease --segment-length to about half the read length because TopHat will work better with multiple segments
open: No such file or directory
[main_samview] fail to open "/media/bv/My" for reading.
Warning: junction database is empty!
open: No such file or directory
[main_samview] fail to open "/media/bv/My" for reading.
[2013-07-02 12:54:33] Reporting output tracks
[FAILED]
Error running /usr/bin/tophat_reports --min-anchor 8 --splice-mismatches 0 --min-report-intron 50 --max-report-intron 500000 --min-isoform-fraction 0.15 --output-dir /media/bv/My Passport/output/ --max-multihits 1 --max-seg-multihits 10 --segment-length 25 --segment-mismatches 2 --min-closure-exon 100 --min-closure-intron 50 --max-closure-intron 5000 --min-coverage-intron 50 --max-coverage-intron 20000 --min-segment-intron 50 --max-segment-intron 500000 --max-mismatches 2 --max-insertion-length 3 --max-deletion-length 3 -z gzip -p4 --no-closure-search --no-microexon-search --sam-header /media/bv/My Passport/output/tmp/hg19_genome.bwt.samheader.sam --samtools=/usr/local/bin/samtools --bowtie2-max-penalty 6 --bowtie2-min-penalty 2 --bowtie2-penalty-for-N 1 --bowtie2-read-gap-open 5 --bowtie2-read-gap-cont 3 --bowtie2-ref-gap-open 5 --bowtie2-ref-gap-cont 3 /media/bv/My Passport/output/tmp/hg19.fa /media/bv/My Passport/output/junctions.bed /media/bv/My Passport/output/insertions.bed /media/bv/My Passport/output/deletions.bed /media/bv/My Passport/output/fusions.out /media/bv/My Passport/output/tmp/accepted_hits /media/bv/My Passport/output/tmp/left_kept_reads.bam
Loaded 0 junctions

please help me in learning what has went wrong..

[westerman]

HI.. I am a new user of tophat and I have illumina generated RNA seq single end reads of 35ntd length. Here is the error I am getting when I tried to run tophat...

root@ubuntu:~# tophat -g 1 -p 4 -o '/media/bv/My Passport/output' '/home/bv/Desktop/b/bowtie2-2.1.0/index/hg19' '/media/bv/My Passport/Normal/normal.fastq'
(... much deleted ...)
[main_samview] fail to open "/media/bv/My" for reading.
(... more deleted ...)
please help me in learning what has went wrong..

You have spaces in your path/file names. Yes, I know that you quoted them in your tophat command line and thus they should be ok even with a space. Never-the-less in subsequent steps they became unquoted. I suggest that you put your files in a path without spaces in in; e.g., MyPassport instead of My Passport.

BTW, jp's comment has nothing to do with your problem.