Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • zlu
    Member
    • Nov 2008
    • 34

    bwa sampe max insert size

    Dear BWA users,

    Checking through the sam file produced from the following commands:

    bwa sampe -a 2792 ref.fa read1.sai read2.sai read1.fq read2.fq > read.pe.bwa.sam

    I have found a high percentage of pairings with insert size much greater that the 2792bp specified with the -a option (examples belwo). Have anyone seen this and do you have an explanation? Thank you

    EBRI093151:5:1:41:1387#0 97 Chr5 117315749 37 36M = 117330940 15227 CTTTTTTTGCCTAACAGTTACTGACAGTCNAAACAC BBBBABBABABBBBA@=7BBBB:@ABA78%8A@>@@ XT:A:U NM:i:1 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:29A6
    EBRI093151:5:1:41:1387#0 145 Chr5 117330940 0 36M = 117315749 -15227 TAAAGACAGAAAGGTGAGACAAAATCATACAAGAAT BAA@@?CBBBAA@BBBAB?ABCCBBB?BBCACBCCA XT:A:R NM:i:0 SM:i:0 AM:i:0 X0:i:4 X1:i:2 XM:i:0 XO:i:0 XG:i:0 MD:Z:36


    EBRI093151:5:1:45:1788#0 113 Chr12 30926022 37 36M = 39099548 8173526 AACAACNCTCAATTGTGGATGTGACATGATGGAAGT B??@>:%=?BBB<A@@AB8BBCB@BA@@BBBBBBBB XT:A:U NM:i:1 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:6A29
    EBRI093151:5:1:45:1788#0 177 Chr12 39099548 0 36M = 30926022 -8173526 AGCATTTTTCATGATGTACTCTGCATATAAGTTAAA @=?BBABBBBBBABBB@@ABBBBB?CBBBBB>BBBA XT:A:R NM:i:0 SM:i:0 AM:i:0 X0:i:204 XM:i:0 XO:i:0 XG:i:0 MD:Z:36

Latest Articles

Collapse

  • GATTACAT
    Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
    by GATTACAT
    Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
    07-01-2026, 11:43 AM
  • SEQadmin2
    Nine Things a Sample Prep Scientist Thinks About Before Sequencing
    by SEQadmin2


    I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.

    Here are nine questions we think about, in roughly the order they matter, before...
    06-18-2026, 07:11 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by SEQadmin2, 07-02-2026, 11:08 AM
0 responses
9 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 06-30-2026, 05:37 AM
0 responses
12 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 06-26-2026, 11:10 AM
0 responses
20 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 06-17-2026, 06:09 AM
0 responses
54 views
0 reactions
Last Post SEQadmin2  
Working...