Homemade Primer TruSeq 1.0/2.0

[Lilip]

Hey,

I want to have the primers used on TruSeq kit make on a different company from Illumina.

I have the following sequences:

PCR Primer 1.0
5 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGA 3

PCR Primer 2.0
5 CAAGCAGAAGACGGCATACGAGAT

It is supposed to have phosphorothioate bonds between the two last (3') nucleotides? I checked the primers for the RRBS protocol ( nature) and the phosphorothioate bonds are between a C and T. So, these primers (1.0 and 2.0) should have this modification? If even they doesn't have CT in their 3'end?

Someone has tried that before?

Thx

[Lilip]

http://genomics.med.tufts.edu/documents/protocols/TUCF_Understanding_Illumina_TruSeq_Adapters.pdf

[kcchan]

The primers you have listed are meant for qPCR, not adapter ligation. You can also use these primers for the PCR amplification step. They do not need any special modifications for these two purposes.

I'm not exactly sure what the rules are for listing the actual Illumina TruSeq adapter sequences. I've seen some posts not showing the design and sequence of the adapters citing copyright issues.

[Lilip]

Hey Kcchan

Yes, those primers are for PCR step. But after that I am gonna send for sequencing. So is that correct to use those primers for preparing the libraries?

[kwaraska]

No-you need adapters on the end of the DNA first.

Please look at the referenced someone cited above.

[Lilip]

Ok guys,

I cited the reference above. I have exactly those adapters sequence, and I really want to have more Primers 1.0 and 2.0, since I am running out of them, and I have adapters enough.

The question is: Do I need to add the phosphorothioate modification to the 3'end?

I checked on the internet and all the primers that has this modification they end in TCT. But this is not the case for Primer 1.0 and 2.0

kwaraska, I did not undestand what you mean. The "No" menas I "Don't need to add the modification?" Or the "No" is I can't use the primers for preparing libraries.

[kwaraska]

The PCR primer 1.0 and 2.0 are for the old style (non-truseq) primers. They are different from the current Y-adapter style.

If you are using the TruSeq style, these will not amplify them.

If you are an Illumina customer, there is a document with all the sequences, but those listed are not the correct primers according to Iluumina. They may work however.

There is a paper from the Sanger Institute that talks about this very issue. I only have a hard copy or I would give you the link, but it gives the sequences, the modifications and how to prepare the double stranded adapters. That is what we used to make ours.

[Lilip]

Hey kwaraska

I am sorry to insist on that. But if you see the Truseq adapter sequence
at the link, you will notice that just the last nucleotides are complematary, so f this is a kind of Y-style. Am I wrong?