[cosmarium]

I found this page, maybe this is what you are looking for? I hope this helps:

http://intron.ccam.uchc.edu/groups/tgcore/wiki/013c0/Solexa_Library_Primer_Sequences.html

Best,

C

[Zebrafish]

PE primers

Hi,

I am looking for PE primer 1.0 and primer 2.0 sequences that people have good experience with. There is too much confusion whether these primers need to be modified at 3' (LCNA or phosphothioate).

Can anyone share exact modifications for primers and their sequences? I already have lot of adapters that come with PE oligo kit but ran out of primers.

Thanks
Shob

[bluescapebioo]

thanks a lot

[soban]

Hi, what is the range of DNA reduced representation libraries sequence length, its 200-300bp, the older one, what is the newer length range?.

[tldgID]

Sorry for the small font, but that's the only way I could make it fit


Paired-end DNA

PE Adapter1:
5' -------------------- -----ACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------------- -------------------- - 3'
3' -------------------- -----TGTGAGAAAGGGATG TGCTGCGAGAAGGCTAGp (-) -------------------- -------------------- -------------------- - 5'
PE Adapter2:
5' -------------------- -------------------- ------------------ (-) pGATCGGAAGAGCGGTTCAG CAGGAATGCCGAG------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTC------- -------------------- - 5'
PE PCR Primer1:
5' AATGATACGGCGACCACCGA GATCTACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) -------------------- -------------------- -------------------- - 5'
PE PCR Primer2:
5' -------------------- -------------------- ------------------ (-) -------------------- -------------------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTCTGGCTAG AGCATACGGCAGAAGACGAA C 5'
Result Library:
5' AATGATACGGCGACCACCGA GATCTACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (N) AGATCGGAAGAGCGGTTCAG CAGGAATGCCGAGACCGATC TCGTATGCCGTCTTCTGCTT G 3'
3' TTACTATGCCGCTGGTGGCT CTAGATGTGAGAAAGGGATG TGCTGCGAGAAGGCTAGA (N) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTCTGGCTAG AGCATACGGCAGAAGACGAA C 5'
PE DNA Sequencing Primer1
5' -------------------- -----ACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) -------------------- -------------------- -------------------- - 5'
PE DNA Sequencing Primer2
5' -------------------- -------------------- ------------------ (-) -------------------- -------------------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTCTGGC--- -------------------- - 5'

Hi all,

Can anyone point me to a reference for this sequence? following the Illumina TruSeq kit, the final PE TruSeq product doesn't look like this for me. Especially for the top read, after the Ns, where the 3' adapter is, seems to be different.

Really appreciate any feedback!

[protist]

Hi all,

Can anyone point me to a reference for this sequence? following the Illumina TruSeq kit, the final PE TruSeq product doesn't look like this for me. Especially for the top read, after the Ns, where the 3' adapter is, seems to be different.

Really appreciate any feedback!

The library schematic you are looking at is for legacy Illumina adapters not the the TruSeq versions. The original adapters required a PCR step to add the portion of the library that attaches to the Flowcell. The True Seq adapters are complete and there are some sequence differences to the original non-True Seq versions - check the Illumina customer letter for the correct sequemces.

[tldgID]

The library schematic you are looking at is for legacy Illumina adapters not the the TruSeq versions. The original adapters required a PCR step to add the portion of the library that attaches to the Flowcell. The True Seq adapters are complete and there are some sequence differences to the original non-True Seq versions - check the Illumina customer letter for the correct sequemces.

Thanks protist! not sure what 'legacy Illumina adapters' are thought! and I couldn't find any information about them on Illumina website or customer letter. But anyways, thanks.

[protist]

Thanks protist! not sure what 'legacy Illumina adapters' are thought! and I couldn't find any information about them on Illumina website or customer letter. But anyways, thanks.

The original adapters (what I called legacy) released by Illumina are not exactly the same sequence as the currently in use TruSeq adapters - e.g. old adapters did not have indexes TruSeq ones do. The sequences for the individual TruSeq adapters can be found in the Illumina customer letter (see attached) which can also be downloaded from the Illumina website. I have also attached an alignment I had illustrating the differences between the original adapters and the currently in use TruSeq adapters.

[tldgID]

This is a great comparison protist! thank you!

[costamc]

Hi,
I've been trying to sequence the V3-V4 region of the 16S gene was hoping touse my forward and reverse primers as my sequencing primers and the reverse compliment of the reverse primer as my index primer. The problem I just found during a real time PCR to determine sequencing primer efficiency is that the primers will not bind their targets efficiently at the required temperature (65oC).
We can easily increase the length of the sequencing primers going back into the Illumina adapters, but I am afraid that when I increase the length of the index primer I will end up out of the conservative region. I've tried including several degeneracies, but the lowest Tm is never higher than 65oC.
the reverse primer I choose is the S-D-Bact-0785-a-A-21: 5′-GACTACHVGGGTATCTAATCC-3

I appreciate any ideas or comments.

Marcio.

[mchikri]

Hi
I m new and happy to be part of seqanswers
I hope to learne and to be also usful
mchikri

[bssharma]

Insert length?

Can anyone plz tell mE what is the insert length (bp) (assuming adaptor length is 60bp on each end) for 350bp DNA fragment subjected to paired end sequencing.
THANKS!

[pmiguel]

Can anyone plz tell mE what is the insert length (bp) (assuming adaptor length is 60bp on each end) for 350bp DNA fragment subjected to paired end sequencing.
THANKS!

230 bp? (350 - (2 x 60))
Not entirely clear what you are asking, though. I am presuming by "350 bp DNA fragment" you mean, 350 bp amplicon.

--
Phillip

[bssharma]

Hi, I think i got my answer, thanks. If you can also tell me in Illumina sequencing which sequencing read length format generates overlapping end? and how long is the overlapping region for 230bp insert?
Thank you so much

[bssharma]

230 bp? (350 - (2 x 60))
Not entirely clear what you are asking, though. I am presuming by "350 bp DNA fragment" you mean, 350 bp amplicon.

Hi, I think i got my answer, thanks. If you can also tell me in Illumina sequencing which sequencing read length format generates overlapping end? and how long is the overlapping region for 230bp insert?
Thank you so much