Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • SeqTruth
    Member
    • Apr 2009
    • 12

    #16
    Does anyone have explicit, detailed information about the new TruSeq adaptor sequences and structures?

    Comment

    • huqiuping
      Junior Member
      • Feb 2010
      • 1

      #17
      I have same question.
      Originally posted by seqgirl123 View Post
      Hi,

      I am a little confused with the various schematics I found on the Solexa adapter structure.

      I followed Illumina's pdf (attached) and made the forked structure myself (jpeg). I also listed the variations I saw on the right taken from various schematics people have posted on this website which I think they took from other journal articles.

      Can someone tell me if the sequences taken from Illumina's pdf are the correct forked structures as I've drawn them, meaning is that the way they're really supposed to look? My version has more bases ligating to each other versus the ones taken from this website which have fewer, why is that and does it make a difference? Thanks.

      Comment

      • protist
        Senior Member
        • Jan 2009
        • 101

        #18
        Originally posted by SeqTruth View Post
        Does anyone have explicit, detailed information about the new TruSeq adaptor sequences and structures?
        In an Illumina webinar yesterday it was stated that they are equivalent to 'complete adapters' ie., they have the extension which is normally added during the library amplification that allows the library material to anneal to the Flowcell. Thus if you start with enough material you could potentially skip the Library amplification step.

        See paper below for discussion of 'complete adapters'
        Nature Methods 6, 291 - 295 (2009) Amplification-free Illumina sequencing-library preparation facilitates improved mapping and assembly of (G+C)-biased genomes

        Comment

        • marcaill
          Junior Member
          • Jul 2008
          • 6

          #19
          Thanks Protist.
          That's what we understood too. The ultimate goal would be indeed to avoid PCR step.
          I'm looking forward adapters sequences for confirmation...

          Comment

          • protist
            Senior Member
            • Jan 2009
            • 101

            #20
            Originally posted by huqiuping View Post
            I have same question.
            I have attached a figure I use as an explanation - hope it helps.
            Attached Files

            Comment

            • genlyai
              Member
              • Aug 2009
              • 39

              #21
              Thanks, Scott.

              What I'm confused about is the PCR primers that are used with the TruSeq DNA and RNA adapters. Can you (or someone) clarify what those are?

              Comment

              • NextGenSeq
                Senior Member
                • Apr 2009
                • 482

                #22
                You have to ask Illumina for them. I posted a pdf of them but Illumina made this site take them down.

                Comment

                • ECO
                  --Site Admin--
                  • Oct 2007
                  • 1360

                  #23
                  Hi guys/ScottC,

                  NextGenSeq is correct, ILMN does not want the TruSeq adapter sequences published here.

                  Apologies...

                  Comment

                  • ScottC
                    Senior Member
                    • Jan 2008
                    • 244

                    #24
                    Originally posted by NextGenSeq View Post
                    You have to ask Illumina for them. I posted a pdf of them but Illumina made this site take them down.
                    Originally posted by ECO View Post
                    Hi guys/ScottC,
                    NextGenSeq is correct, ILMN does not want the TruSeq adapter sequences published here.
                    Apologies...
                    Really? You were actually told by Illumina to remove them? Why would they care? It was sent to me out of the blue by Illumina staff, I didn't request it. They told me to feel free to distribute it.

                    You're certainly allowed to publish 'individual sequences'...

                    "For individual sequences contained in this letter, lllumina grants you permission to distribute them outside your institution, or publish individual sequences in presentations, manuscripts, or publications authored by you, as long as it is accompanied by the following copyright notice:
                    Oligonucleotide sequences © 2007‐2011 Illumina, Inc. All rights reserved."

                    Comment

                    • ECO
                      --Site Admin--
                      • Oct 2007
                      • 1360

                      #25
                      Yup. In this thread when they were posted initially, I received a very nice email from their Senior Patent Counsel. Post#4 in that thread has the statement ILMN asked me to include with the takedown.

                      I hadn't seen that release above...the original posting did have that copyright attached as I remember.

                      Comment

                      • SeqTruth
                        Member
                        • Apr 2009
                        • 12

                        #26
                        Ok, so somebody can maybe post those pdfs on a website somewhere, with some obvious search terms associated, and anyone with access to Google can find and download them; a minor inconvenience for now.

                        For those of us who already have the pdf with all the TruSeq sequences, it would be nice if someone could clarify the question of library amplification PCR primers for the TruSeq DNA and RNA sample prep kits...?

                        Comment

                        • seqgirl123
                          Member
                          • Oct 2008
                          • 78

                          #27
                          Does anyone have a schematic illustration (similar to what kmcarr has posted in this thread for SE and PE library construction and sequencing) when using Illumina's multiplex kits for library construction and sequencing. So far, I have seen the single end and paired end library construction and sequencing illustrations and they have been great learning tools for a lot of us here. Can someone post the same schematic for the multiplex library construction and sequencing?

                          In Illumina's version of multiplexing, they have a multiplex adapter, multiplex PCR primers, and a separate PCR index primer (3 PCR primers in all). The newer TruSeq kits brought this down to only 2 PCR primers in all, so there is only a multiplex adapter and the multiplex PCR primers (the index sequence is contained in the multiplex PCR primer I think is how it works). So I'm really looking for a schematic on Illumina's original multiplex kit and would much appreciate if someone can post their multiplex illustration here.

                          Comment

                          • lizhen
                            Junior Member
                            • Apr 2012
                            • 1

                            #28
                            40% adaptor sequence

                            Thanks kmcarr, seggirl123 and protist for you kind sharing! These information are really helpful!

                            I just constructed 8 CHIP-SEQ libraries with 3 different input and 5 different CHIP libraries. After sequencing, the mapping result showed around 40% are adaptor sequence "GATCGGAAGAGCTCGTATGCCGTCTTCTGCTT" . Could anyone suggest which step could be wrong for the library preparation?

                            Thanks!

                            Comment

                            • captainentropy
                              Member
                              • Mar 2009
                              • 89

                              #29
                              Originally posted by lizhen View Post
                              Thanks kmcarr, seggirl123 and protist for you kind sharing! These information are really helpful!

                              I just constructed 8 CHIP-SEQ libraries with 3 different input and 5 different CHIP libraries. After sequencing, the mapping result showed around 40% are adaptor sequence "GATCGGAAGAGCTCGTATGCCGTCTTCTGCTT" . Could anyone suggest which step could be wrong for the library preparation?

                              Thanks!
                              Size selection is your problem step. The adapters will form a product after PCR of ~124bp. If you size-select your library on a gel you are certainly cutting out your block of DNA-embedded agarose too close to where the adapters run. To avoid this run your library on a long gel and at low voltage, in a cold room is even better (according to Illumina). This should give you better separation of your library from the free adapters.

                              But, if you have access to a Pippin Prep instrument that will be even better. It will electro-elute your desired size range. It's a much cleaner method.

                              I've actually abandoned the Pippin and size-select after PCR. I do all of my DNA clean up steps with Ampure XP beads and PCR amplify the library first, then size-select. I never get adapter contamination anymore (I didn't with the Pippin either but my new method is way faster, has greater yield, and is cheaper).

                              Also, you should always run your library on a Bioanalyzer 2100 before you sequence. You can always size-select your library again to remove the problematic adapter concatamer. Otherwise, without this important quality control step you just might be wasting sequencing depth and wasting money.

                              Comment

                              • TonyBrooks
                                Senior Member
                                • Jun 2009
                                • 303

                                #30
                                We've just started using the eGel system and it's a great piece of kit. Relatively cheap to buy and run, it's clean and quick (takes about 30 minutes from start to finish). Although it doesn't work well on TruSeq libraries which migrate at funny speeds in the gel.

                                Comment

                                Latest Articles

                                Collapse

                                • SEQadmin2
                                  Nine Things a Sample Prep Scientist Thinks About Before Sequencing
                                  by SEQadmin2


                                  I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.

                                  Here are nine questions we think about, in roughly the order they matter, before...
                                  06-18-2026, 07:11 AM
                                • SEQadmin2
                                  From Collection to Sequencing: Why Sample Preparation and Preservation Define Sequencing Data
                                  by SEQadmin2


                                  Data variability is still an issue in sequencing technologies despite the advances in reproducibility and accuracy of these platforms. But the problem does not originate in the sequencing itself, but in the previous steps, before the sample reaches the sequencer.


                                  The first step is collection, followed by preservation and sample preparation for analysis. Most scientists overlook those steps, but not being careful might just be skewing the experiment’s results.
                                  ...
                                  06-02-2026, 10:05 AM

                                ad_right_rmr

                                Collapse

                                News

                                Collapse

                                Topics Statistics Last Post
                                Started by SEQadmin2, Today, 05:37 AM
                                0 responses
                                5 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 06-26-2026, 11:10 AM
                                0 responses
                                16 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 06-17-2026, 06:09 AM
                                0 responses
                                50 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 06-09-2026, 11:58 AM
                                0 responses
                                110 views
                                0 reactions
                                Last Post SEQadmin2  
                                Working...