Tweet
yes, I think..see the link from where I got those files
-
-
That's normal, the fasta file(s) (*.fa) is/are used to make the indices (*.bt2), so there's no reason for it to create a copy.Comment
-
I think the fasta file is in fasta format, as when I open it in texteditor, the first few lines looks like this
>1
CCCTAAACCCTAAACCCTAAACCCTAAACCTCTGAATCCTTAATCCCTAAATCCCTAAATCTTTAAATCC
TACATCCATGAATCCCTAAATACCTAATTCCCTAAACCCGAAACCGGTTTCTCTGGTTGAAAATCATTGT
GTATATAATGATAATTTTATCGTTTTTATGTAATTGCTTATTGTTGTGTGTAGATTTTTTAAAAATATCA
TTTGAGGTCAATACAAATCCTATTTCTTGTGGTTTTCTTTCCTTCACTTAGCTATGGATGGTTTATCTTC
ATTTGTTATATTGGATACAAGCTTTGCTACGATCTACATTTGGGAATGTGAGTCTCTTATTGTAACCTTA
GGGTTGGTTTATCTC,
when i open this file in the terminal it looks
cat Arabidopsis_thaliana_NCBI_TAIR10/Arabidopsis_thaliana/NCBI/TAIR10/Sequence/Bowtie2Index/genome.fa
XSym
0029
7ec8fcfa270da919afc1f0afd221e788
../WholeGenomeFasta/genome.fa
so fasta file seems to be goodComment
-
ok,,now I understand that why I don't see copy of fasta file, when I create indicesComment
-
Ah, after a bit of googling and a hunch, are you using Mac OSX and these files are being held on a fat32 formatted file system (likely an external hard drive, or maybe even a network share via samba)? That is what a symbolic link looks like in these situations (who knew?). If you get this result when you use cat, then I expect the link is also not transparent for gtf_to_fasta. In that case, you might have to copy the ../WholeGenomeFasta/genome.fa file to Arabidopsis_thaliana_NCBI_TAIR10/Arabidopsis_thaliana/NCBI/TAIR10/Sequence/Bowtie2Index/genome.faOriginally posted by hathiram2 View PostComment
-
libz warning?
dpryan, how does one ignore the libz warning? I got that warning while trying to use bam2fastx from top hat 2.0.9...Originally posted by dpryan View PostComment
-
Data variability is still an issue in sequencing technologies despite the advances in reproducibility and accuracy of these platforms. But the problem does not originate in the sequencing itself, but in the previous steps, before the sample reaches the sequencer.
The first step is collection, followed by preservation and sample preparation for analysis. Most scientists overlook those steps, but not being careful might just be skewing the experiment’s results.
...06-02-2026, 10:05 AM -
With the launch of new single-cell sequencing platforms in 2026, the field stands at an exciting inflection point. This article surveys the most impactful advances in the field and discusses how they’re reshaping research in cancer, immunology, and beyond.
Introduction
Single-cell sequencing technologies have undergone remarkable advances over the past decade, transitioning from low-throughput experimental approaches to highly scalable platforms capable of...05-22-2026, 06:42 AM -
Studying ecosystems means dealing with complex, multi-species communities that are hard to observe at scale. This complexity, however, hides many important questions to be answered, from how biogeochemical cycles work and how climate change can affect species distribution to how conservation strategies can work best.
Genomics, particularly since the expansion of NGS, has transformed ecosystem ecology. By sequencing environmental DNA, we can now assess biodiversity without direct...05-06-2026, 09:04 AM
Comment