Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • paa6
    Member
    • Feb 2014
    • 68

    #16
    @sklages I have two types of reads files one is in .sff format and other one is .qual format. First I tried to converted .qual into .fasta and performed assembly using geneious and velvet both software but contigs didnt generate.

    After discussing my problem in this forum, I came to conclusion that .qual is not an illumina seuencer file (according to my supervisor). So now I have tried to import .sff file into geneious to perform assembly but geneious is showing error message.

    Comment

    • sklages
      Senior Member
      • May 2008
      • 628

      #17
      Originally posted by paa6 View Post
      @skladge can u provide me any research paper mentioning that to assembl the 454 u need all these formats...so that I can show him proof. He was telling me that .qual is an Illumina sequencing file and .sff is 454 sequencing. So, obviously if i will try to explain him that they both are the same file of 454 sequencing and I need additional files too...so, I need to show him research paper...
      can you paste the first few lines of the *qual* file so that we can see what format you have?

      What is the output of:

      Code:
      strings yourFile.sff | grep run_type
      strings yourFile.sff | grep instrument_model
      Both should help us to determine what kind of files you have.

      Comment

      • mastal
        Senior Member
        • Mar 2009
        • 666

        #18
        Originally posted by paa6 View Post
        @skladge can u provide me any research paper mentioning that to assembl the 454 u need all these formats...so that I can show him proof. He was telling me that .qual is an Illumina sequencing file and .sff is 454 sequencing. So, obviously if i will try to explain him that they both are the same file of 454 sequencing and I need additional files too...so, I need to show him research paper...
        see Lex Nederbragt's blog, starting with this page about sff files:

        Newbler can obviously take in the 454 reads, but also other read types: regular Sanger reads, any sequence in a fasta file (at most 200 bp), and perhaps also Illumina reads. Sff files are the stand…

        Comment

        • paa6
          Member
          • Feb 2014
          • 68

          #19
          @SKLADGE

          This is the first few lines of .sff file... I opened this file using less command in linux.. .sff^@^@^@^A^@^@^@^@.<E9><E8><A0>^@I<9E><A4>^@^C<AE>;^CH^@^D^C ^ATACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT

          This is the first few lines of .qual file...I opened this file using less command in linux... >F0ZETIM04H8105 length=79 xy=3266_2039 region=4 run=R_2009_08_18_04_59_32_
          36 35 35 37 37 37 37 37 37 35 35 40 39 39 39 40 40 40 40 40 39 39 39 40 40 39 39 39 37 37 37 38 38 37 31 23 23 21 20 19 27 30 30

          Comment

          • paa6
            Member
            • Feb 2014
            • 68

            #20
            Originally posted by mastal View Post
            see Lex Nederbragt's blog, starting with this page about sff files:

            http://contig.wordpress.com/2010/10/...file/#more-207
            thanks I will go through this...blog..

            Comment

            • sklages
              Senior Member
              • May 2008
              • 628

              #21
              Originally posted by paa6 View Post
              @SKLADGE

              This is the first few lines of .sff file... I opened this file using less command in linux.. .sff^@^@^@^A^@^@^@^@.<E9><E8><A0>^@I<9E><A4>^@^C<AE>;^CH^@^D^C ^ATAC<shortened>ACGTACGTACGTACGTACGTACGTACGT

              This is the first few lines of .qual file...I opened this file using less command in linux... >F0ZETIM04H8105 length=79 xy=3266_2039 region=4 run=R_2009_08_18_04_59_32_
              36 35 35 37 37 37 37 37 37 35 35 40 39 39 39 40 40 40 40 40 39 39 39 40 40 39 39 39 37 37 37 38 38 37 31 23 23 21 20 19 27 30 30

              Concerning your qual file: This is a 454 generated file, F0ZETIM04H8105 is the read id, xy are the coordinates, data is from region 4, the run took place at "2009_08_18".

              Please, for the .sff file use the provided 'strings' commands. That's your "proof" then for your PI.

              Comment

              • paa6
                Member
                • Feb 2014
                • 68

                #22
                Originally posted by sklages View Post
                Concerning your qual file: This is a 454 generated file, F0ZETIM04H8105 is the read id, xy are the coordinates, data is from region 4, the run took place at "2009_08_18".

                Please, for the .sff file use the provided 'strings' commands. That's your "proof" then for your PI.
                ohh ok ...let me try these commands...do I need any specific environment for that??

                Comment

                • sklages
                  Senior Member
                  • May 2008
                  • 628

                  #23
                  Originally posted by paa6 View Post
                  ohh ok ...let me try these commands...do I need any specific environment for that??
                  No. Just a shell. Then type the command on the command line.

                  Comment

                  • GenoMax
                    Senior Member
                    • Feb 2008
                    • 7142

                    #24
                    Guess we are convinced that this appears to be a 454 dataset (not illumina nor SOLiD).

                    @paa6: Ask the PI about missing corresponding "fna" files (which will have the actual sequence). If you can't get those files (and if the SFF files are corrupt) there is not much you are going to be able to do with just quality values.

                    Comment

                    • paa6
                      Member
                      • Feb 2014
                      • 68

                      #25
                      Originally posted by sklages View Post
                      No. Just a shell. Then type the command on the command line.
                      I tried these commands..no error message but file didn't open...what to do...

                      Comment

                      • paa6
                        Member
                        • Feb 2014
                        • 68

                        #26
                        Originally posted by GenoMax View Post
                        Guess we are convinced that this appears to be a 454 dataset (not illumina nor SOLiD).

                        @paa6: Ask the PI about missing corresponding "fna" files (which will have the actual sequence). If you can't get those files (and if the SFF files are corrupt) there is not much you are going to be able to do with just quality values.
                        yeah I think so you are right...ok I will talk to him and let u know what he replied...

                        Comment

                        • sklages
                          Senior Member
                          • May 2008
                          • 628

                          #27
                          He wanted a "proof"; checking for run_type or instrument_model gives him this "proof". :-)

                          It should be clear though that his dataset is incomplete; missing sequence file(s), possibly truncated SFF file. Maybe there were some problems during transfer to the USB device? Who knows ..

                          He could even check this: the final rows of 'strings' run on an SFF file should give the manifest followed by the read IDs ..

                          Comment

                          • sklages
                            Senior Member
                            • May 2008
                            • 628

                            #28
                            Originally posted by paa6 View Post
                            I tried these commands..no error message but file didn't open...what to do...
                            Again, please give us a bit more details,

                            What did you type and what did you get?

                            Comment

                            • paa6
                              Member
                              • Feb 2014
                              • 68

                              #29
                              Originally posted by sklages View Post
                              He wanted a "proof"; checking for run_type or instrument_model gives him this "proof". :-)

                              It should be clear though that his dataset is incomplete; missing sequence file(s), possibly truncated SFF file. Maybe there were some problems during transfer to the USB device? Who knows ..

                              He could even check this: the final rows of 'strings' run on an SFF file should give the manifest followed by the read IDs ..
                              YEAH RIGHT...thanks a lot...at least I can say this to him...and am sorrry now it's 12.16 a.m. here.....i am tired so i will reply u in the morning.

                              Comment

                              • paa6
                                Member
                                • Feb 2014
                                • 68

                                #30
                                Originally posted by sklages View Post
                                Again, please give us a bit more details,

                                What did you type and what did you get?
                                I have typed
                                strings filename.sff | grep run_type
                                and then there is no change in the screen, so I typeed next command

                                strings filename.sff | grep instrument_model

                                but still no change in he screen, I mean file didn't open...

                                Comment

                                Latest Articles

                                Collapse

                                • SEQadmin2
                                  Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                                  by SEQadmin2



                                  CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                                  Despite this, “CRISPR helped turn genome editing from a specialized technique into
                                  ...
                                  07-31-2026, 11:01 AM
                                • SEQadmin2
                                  Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                                  by SEQadmin2


                                  Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                                  The systematic characterization of the human proteome has
                                  ...
                                  07-20-2026, 11:48 AM
                                • SEQadmin2
                                  Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                                  by SEQadmin2



                                  Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                                  ...
                                  07-09-2026, 11:10 AM

                                ad_right_rmr

                                Collapse

                                News

                                Collapse

                                Topics Statistics Last Post
                                Started by SEQadmin2, Today, 07:41 AM
                                0 responses
                                9 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 08-03-2026, 10:13 AM
                                0 responses
                                25 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-31-2026, 02:55 AM
                                0 responses
                                38 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-24-2026, 12:17 PM
                                0 responses
                                25 views
                                0 reactions
                                Last Post SEQadmin2  
                                Working...