[dalin]

I wonder if you are using custom sequencing primers. Your read2 sequencing primer might not be optimal in addition to other reasons given previously. I think you need to provide more information about the library and sequencing metrics to enable others to help you effectively.

i am new in this field. can anyone tell me how to check the cluster density. just in case this is casued by amplicon diversity issue， is there any trick to aviod this problem happens again. thank you guys so much！

I will send more sequencing metrics.

[dalin]

Read1

[IMG][/IMG]

[dalin]

[dalin]

read2

[dalin]

I wonder if you are using custom sequencing primers. Your read2 sequencing primer might not be optimal in addition to other reasons given previously. I think you need to provide more information about the library and sequencing metrics to enable others to help you effectively.

in this library,i use the custom sequencing primers
P5 primer:AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
P7 primer:CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC

[weigrc]

thanks for your reply， which explained a lot. Yes I am using amplicon. The worse is that my library has only about 20bp diverse sequence in 5 and 3 end. the sequence in between is a linker， means there is no diverse at all. i cannot change my library. but hope there will be a trick to circle this problem.

After these FastQC reports and your explanation, the issue should not be generated by over-clustering.

As nucacidhunter said, you may give more info for trouble shoot, like listed below:

(1) What/which protocol/kit for library construction?
(2) Adapter system you used? e.g. Nextera or TruSeq LT, if you used custom primers / adaptors, please give intact sequences of them, cannot recognize "the sequencing primers" you provided.
(3) Sequencing run type you used? eg. V3 high output run of HiSeq PE100.
(4) % of PhiX spike-in?

[Brian Bushnell]

I wait with bated breath. This is the most terrible run I have ever seen! It looks to me like it ran out of reagent after 100 cycles, but I'm betting on nucacidhunter for diagnosing it correctly.

[dalin]

I wait with bated breath. This is the most terrible run I have ever seen! It looks to me like it ran out of reagent after 100 cycles, but I'm betting on nucacidhunter for diagnosing it correctly.

Thanks for reply, In this library,i only PCR amplification for about 19 cycles......

[dalin]

After these FastQC reports and your explanation, the issue should not be generated by over-clustering.

As nucacidhunter said, you may give more info for trouble shoot, like listed below:

(1) What/which protocol/kit for library construction?
(2) Adapter system you used? e.g. Nextera or TruSeq LT, if you used custom primers / adaptors, please give intact sequences of them, cannot recognize "the sequencing primers" you provided.
(3) Sequencing run type you used? eg. V3 high output run of HiSeq PE100.
(4) % of PhiX spike-in?

in this library,i use the custom sequencing primers
P5 primer:AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
P7 primer:CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC

With the custom sequencing primers, the library sequence is
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT--NNNNNNNNNNNNNNNNNNNN------GTCGGAGAATTCCTTACTAGTAGAACTCTGTTCTTGAGCTAGCATCGATGCTAGCTCAAGAACAGAGTTCTACTAGTAAGGAATTCTCCGAC----NNNNNNNNNNNNNNNNNNNN---GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG
thanks a lot!

[nucacidhunter]

From provided information I assume that your library insert size is around 130 bp with middle 90 bases being the same in all inserts and flanking 5' and 3' 20 bases divergent. The library structure contains truncated universal LT P5 and index1 P7 adapter with additional bases. Considering the position of P5 deletion and P7 addition this library should be suitable for sequencing with standard MiSeq reagents. Read1 sequence quality drops below 30 around 60th cycle which is below expected for 100 cycle sequencing. I would suggest that read2 low quality has been caused either by a fault in sequencer or MiSeq reagents. Reagents could have been faulty or used past expiry date or recommended handling has not been followed.

You have not mentioned the library prep method, but the data suggests that mid sequences of insert are not exactly the same.

[dalin]

From provided information I assume that your library insert size is around 130 bp with middle 90 bases being the same in all inserts and flanking 5' and 3' 20 bases divergent. The library structure contains truncated universal LT P5 and index1 P7 adapter with additional bases. Considering the position of P5 deletion and P7 addition this library should be suitable for sequencing with standard MiSeq reagents. Read1 sequence quality drops below 30 around 60th cycle which is below expected for 100 cycle sequencing. I would suggest that read2 low quality has been caused either by a fault in sequencer or MiSeq reagents. Reagents could have been faulty or used past expiry date or recommended handling has not been followed.

You have not mentioned the library prep method, but the data suggests that mid sequences of insert are not exactly the same.

Thank you very much,the 5 and 3 flanking divergent sequence are accually 19-21 bp（probally mainly 20）,we used hiseq 2000. other lines in this run looks fine. so it may not likely caused by reagent.
you suggest help me a lot, thank you!

[ashleylose07]

I'm sorry i don't know the cluster density of the library. The Sequencing company have no information for the cluster density. teatv spice money login