Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • BearClaw
    Junior Member
    • Feb 2010
    • 9

    #31
    I have pooled libraries before and after SureSelect targeted enrichment. The barcodes have come out fairly even (within the limitations of the very low amounts of starting material). I am now turning to having my adaptors still have the barcodes as the first six bases of the reads, but with the 'Y' adaptors used by more up-to-date illumina protocols. This has required a redesign of the adaptors. A single example with the barcode AACCTT is below:


    +adaptor 1 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCTAACCT*T 3'
    -adaptor 1 5' [Phos]-AGGTTAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG 3'

    In this case, both read 1 and read 2 will have the barcode sequence, so you need to either balance your barcodes so that the 'A', 'C', 'G' and 'T' are fairly even in the first four cycles (like in my original post with four barcodes). Alternatively, you need to change the protocol of the RTA program to use different cycles (like cycles 7-10) to set phasing and intensity values. The Illumina sales rep can show you how to do this.

    Comment

    • polyhedron
      Member
      • Aug 2009
      • 12

      #32
      Now (sorry for that long time due to many delays) I can report my result for first pooling then capturing: it works, although not perfect.

      I used 4-letter barcode, like:
      5'-adaptor-TAACCT
      3'-adaptor-ATTGGp

      The priliminary results are not so good as capturing without pooling, e.g. shorter read length (got less than <80 but run for 100bp) and worse mappability. And evenness is not so good (we mixed each sample equally using nanodrop rather than the recommended 2100, since we are poor), the highest coverage is about 4 time the lowest, and 23% of reads could not be assigned to any sample according to the barcode (some N got sequenced). So it's fine with SNP discovery, but if coverage is strictly needed or some quantification, I would suggest to improve ro to go other ways.
      Last edited by polyhedron; 09-26-2010, 12:41 AM.

      Comment

      • greigite
        Senior Member
        • Mar 2009
        • 145

        #33
        truncated adapters in library clones

        Hi,
        Thought I'd resurrect this old thread as we are seeing a similar phenomenon in our libraries to the OP. Specifically, we cloned and Sanger sequenced some standard genomic PE libraries and are seeing truncation of the adapters from the 5' end in some libraries, as well as a larger number of molecules containing full PE1 sequences than full PE2 sequences. We used NEB library preparation kits and some custom barcoded adapters from Invitrogen, which contained the phosphothiorate modification and were purified using desalting. Following triplicate 4 cycle PCR, we cloned several of the libraries into the Fermentas blunt end pJet vector and Sanger sequenced several transformants. While some clones looked normal, several had truncations off the 5' end of PE1 (see attachments). These truncated sequences did contain some bases from the PCR primer on both sides, meaning that we weren't just sequencing unamplified ligated molecules, and there were no adapter-only clones. I haven't been able to come up with a reason why the primers themselves should be truncated aside from being poorly synthesized- but that surprises me since I have not had similar problems with Invitrogen oligos in the past. We are not sure what steps to take next- should we just qPCR quantify the libraries with Kapa so we know how many correct molecules are present and use that to estimate loading amounts? Or did we go wrong elsewhere in library prep?
        Attached Files

        Comment

        • athos
          Junior Member
          • Sep 2008
          • 9

          #34
          Originally posted by BearClaw View Post
          The SureSelect kit comes with three blocking reagents. I added 0.6 uL of a fourth blocking reagent. The fourth blocking reagent was made by mixing equal volumes of each 100 uM index primer (+ and - strands). I didn't try this protocol without the added index primer in the block, so am only assuming that it is needed.
          Hi BearClaw,
          I was wondering what size your target region was, and also what percentage of your sequence reads were 'on target'? Sorry if the info is here and I've missed it!
          Cheers
          Last edited by athos; 01-31-2011, 03:53 AM.

          Comment

          • gsavych
            Junior Member
            • Feb 2011
            • 2

            #35
            Originally posted by upenn_ngs View Post
            The sureselect protocol includes blocking oligos during hybridization. For a paired-end library prep, novel sequence is introduced to the ends of genomic fragments by ligation and asymmetric pcr. The blocking oligos are used during hybridization to prevent duplex formation between the adapter regions of the genomic fragments. If the prepped library was not blocked, targeted fragments would also capture nonspecific fragments annealed to the adapters, making the targeted region a lesser proportion of the capture. As a result, a greater amount of sequencing capacity would be needed to achieve the desired depth of coverage.

            That said, the paired-end and the multiplex oligos are very similar. It is possible that you used the paired-end blocking oligos on the multiplex prepped libraries. I am interested in the method you used, please describe the pooling before hybridization and the post-hybrid amp. When considering this approach we were concerned about bias. We have seen good results with scaled-down (1/5 volume) hybridizations.
            to upenn_ngs
            we are trying out illumina's truseq kit for multiplexing and would also like to use the blockers during the hybridization step. we have all the oligos corresponding to their adapters as well as their reverse compliments that i was gonna add to the hybridization reaction. how much of the blokers would you recommend using?

            Comment

            • upenn_ngs
              Member
              • Sep 2009
              • 70

              #36
              Originally posted by gsavych View Post
              to upenn_ngs
              we are trying out illumina's truseq kit for multiplexing and would also like to use the blockers during the hybridization step. we have all the oligos corresponding to their adapters as well as their reverse compliments that i was gonna add to the hybridization reaction. how much of the blokers would you recommend using?
              Short answer: Final [ ] for each oligo 50uM

              The truseq multiplexed libraries include the index before the enrichment. To maintain the integrity of these barcodes, we use a short-oligo strategy to block the clustering and the sequencing elements. See attached.
              Attached Files

              Comment

              • gsavych
                Junior Member
                • Feb 2011
                • 2

                #37
                Originally posted by upenn_ngs View Post
                Short answer: Final [ ] for each oligo 50uM

                The truseq multiplexed libraries include the index before the enrichment. To maintain the integrity of these barcodes, we use a short-oligo strategy to block the clustering and the sequencing elements. See attached.
                thanks a lot, this is great! just a quick question - what is the purpose of the ddC at the 3' of P7_b2_f?

                Comment

                • upenn_ngs
                  Member
                  • Sep 2009
                  • 70

                  #38
                  Originally posted by gsavych View Post
                  thanks a lot, this is great! just a quick question - what is the purpose of the ddC at the 3' of P7_b2_f?
                  To prevent the oligo from serving as a primer for extension during post-hybridization PCR.

                  Comment

                  • abcd41
                    Junior Member
                    • Apr 2010
                    • 1

                    #39
                    Did anybody try to pull 12 libraries with different indexes together before capture with SureSelect? And then sequenced captured fragments in single lane on HiSeq?
                    Any recommendations?
                    What is the maximum number of libraries can be pooled (before capture) with good results?
                    Any limitation on target size design when plan to capture 12 pooled libraries?

                    Thank you.

                    Comment

                    • Fiona
                      Junior Member
                      • Feb 2011
                      • 3

                      #40
                      Would you provide me the information regarding the contents of each blocking buffer #1, #2, and #3 in the AgilentSureSelect Target Enrichment for Illumina Paired-End Multiplexed Sequencing. And also is there anyone who tried the Nextera DNA samp prep kit + Nimblgen capturing (EZ exome SR ver 2.2) or the Nextera DNA samp prep kit + AgilentSureSelect Target Enrichment for Illumina Paired-End system? How did you prepare the blocking oligos? Thank you!

                      Comment

                      • NextGenSeq
                        Senior Member
                        • Apr 2009
                        • 482

                        #41
                        You can only pool 2 to 3 whole exome captures on a single lane of the HiSeq if you want sufficient coverage for SNP and indel detection.

                        Comment

                        • Fiona
                          Junior Member
                          • Feb 2011
                          • 3

                          #42
                          Thank you for your comment. We will not pool for whole exome sequencing but will pool the samples for targeted sequencing. I just would like to know how we can design the blocking oligos for hybridization of Nextera library (both with barcoded and without barcode) for Illumina Paired-End Sequencing. I would appreciate your information.

                          Comment

                          • Fiona
                            Junior Member
                            • Feb 2011
                            • 3

                            #43
                            The TruSeq library prep kit seems to be compatible with Agilent SureSelect. Do we still need to change or add the blocking oligos for hybridization? Please let me know. Thank you!

                            Comment

                            • ibuyufo
                              Junior Member
                              • Mar 2011
                              • 6

                              #44
                              Has anyone managed to make a homebrew that mimic the sureselect kit?

                              Comment

                              Latest Articles

                              Collapse

                              • SEQadmin2
                                From Collection to Sequencing: Why Sample Preparation and Preservation Define Sequencing Data
                                by SEQadmin2


                                Data variability is still an issue in sequencing technologies despite the advances in reproducibility and accuracy of these platforms. But the problem does not originate in the sequencing itself, but in the previous steps, before the sample reaches the sequencer.


                                The first step is collection, followed by preservation and sample preparation for analysis. Most scientists overlook those steps, but not being careful might just be skewing the experiment’s results.
                                ...
                                06-02-2026, 10:05 AM
                              • SEQadmin2
                                Single-Cell Sequencing at an Inflection Point: Early Impacts of New Platforms and Emerging Trends
                                by SEQadmin2


                                With the launch of new single-cell sequencing platforms in 2026, the field stands at an exciting inflection point. This article surveys the most impactful advances in the field and discusses how they’re reshaping research in cancer, immunology, and beyond.


                                Introduction

                                Single-cell sequencing technologies have undergone remarkable advances over the past decade, transitioning from low-throughput experimental approaches to highly scalable platforms capable of...
                                05-22-2026, 06:42 AM
                              • SEQadmin2
                                Environmental Genomics in the Age of NGS: From Microbes to Conservation Strategies
                                by SEQadmin2

                                Studying ecosystems means dealing with complex, multi-species communities that are hard to observe at scale. This complexity, however, hides many important questions to be answered, from how biogeochemical cycles work and how climate change can affect species distribution to how conservation strategies can work best.


                                Genomics, particularly since the expansion of NGS, has transformed ecosystem ecology. By sequencing environmental DNA, we can now assess biodiversity without direct...
                                05-06-2026, 09:04 AM

                              ad_right_rmr

                              Collapse

                              News

                              Collapse

                              Topics Statistics Last Post
                              Started by SEQadmin2, Yesterday, 08:59 AM
                              0 responses
                              14 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 06-02-2026, 12:03 PM
                              0 responses
                              22 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 06-02-2026, 11:40 AM
                              0 responses
                              19 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 05-28-2026, 11:40 AM
                              0 responses
                              32 views
                              0 reactions
                              Last Post SEQadmin2  
                              Working...