Hello,
I am constructing an ATAC-seq library using the standard Illumina kit (Nextera DNA Flex Library Prep, FC-121-1030). A previous user suggested dual indexing to minimise index hopping which I am grateful for. We have access to a Hiseq X-Ten (paired-end 100bp) and illumina suggests to use the reverse complement of the Index (i5) adapter sequence:
A standard i5 adapter = AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC
What should I order to amplify my transposed libraries? For example with the H502 i5 index: unique bases in adapter = CTCTCTAT, does that mean I would order a primer with the reverse complement (ATAGAGAG) for the unique portion of an i5 standard index? = AATGATACGGCGACCACCGAGATCTACAC [ATAGAGAG] TCGTCGGCAGCGTC instead of AATGATACGGCGACCACCGAGATCTACAC [CTCTCTAT] TCGTCGGCAGCGTC as was used in this protocol presumably becuase they used a different sequencer: https://www.encodeproject.org/docume...l_20170130.pdf
From the original ATAC-seq protocol, they add the following bases to the 3' end of a standard i5 adapter that doesn't contain a unique index sequence. I'd imagine this is to mitigate loss of the 8 base unique index, but they've also added a few bases to the 3' end of the i7 adapters (AGATGT) that do contain a unique index sequence. Should I include this (AGATGTG) to my i5 primer order and can I use these with the i7 adapters as given in the in the Buenrostro 2013 protocol which include the extra 3' bases (AGATGT)?
Best,
Eric
I am constructing an ATAC-seq library using the standard Illumina kit (Nextera DNA Flex Library Prep, FC-121-1030). A previous user suggested dual indexing to minimise index hopping which I am grateful for. We have access to a Hiseq X-Ten (paired-end 100bp) and illumina suggests to use the reverse complement of the Index (i5) adapter sequence:
A standard i5 adapter = AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC
What should I order to amplify my transposed libraries? For example with the H502 i5 index: unique bases in adapter = CTCTCTAT, does that mean I would order a primer with the reverse complement (ATAGAGAG) for the unique portion of an i5 standard index? = AATGATACGGCGACCACCGAGATCTACAC [ATAGAGAG] TCGTCGGCAGCGTC instead of AATGATACGGCGACCACCGAGATCTACAC [CTCTCTAT] TCGTCGGCAGCGTC as was used in this protocol presumably becuase they used a different sequencer: https://www.encodeproject.org/docume...l_20170130.pdf
From the original ATAC-seq protocol, they add the following bases to the 3' end of a standard i5 adapter that doesn't contain a unique index sequence. I'd imagine this is to mitigate loss of the 8 base unique index, but they've also added a few bases to the 3' end of the i7 adapters (AGATGT) that do contain a unique index sequence. Should I include this (AGATGTG) to my i5 primer order and can I use these with the i7 adapters as given in the in the Buenrostro 2013 protocol which include the extra 3' bases (AGATGT)?
Best,
Eric
Comment