I received my fastq files from a ChIP-Seq experiment. The Sequencing core guy told me that the raw data was converted from .bcl file format to .fastq format using CASAVA v1.8.2. They run a standard paired-end sequencing reaction to generate 50 bp of sequence in each direction in the Illumina HiSeq2000 platform.
How do I know whether the fastq files are ready for alignment to generate the bam files using Bowtie? This is because I wonder how to know in the fastq file that the adaptors/barcodes have been removed from the read. If the fastq files still contain these primers how do I know it and how do I trim them.
Below and attaching a couple of reads from the fastq files:
@D5VG2KN1:206:C3LG1ACXX:8:1101:1216:2098 1:N:0:GCCAAT
CTTGACAAGCGCTTTCTTCAGAGTGCCCTCGCTCGTCCTATCTACAAAGCT
+
CCCFFFFFHHHHHJJIJJJJJJJFHIJJJJJJIJDHIJJIJIJJJJJJJJJ
@D5VG2KN1:206:C3LG1ACXX:8:1101:1437:2084 1:N:0:GCCAAT
TTTACCTTGTGTTAATTTTATTCAAAGCCAGAAACAATATGCATCCGGTTG
+
CCCFFFFFHHHHHJIIJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJHJJ
this is kind of basic but and I a newbie in NGS analysis.
thanks for any clues
How do I know whether the fastq files are ready for alignment to generate the bam files using Bowtie? This is because I wonder how to know in the fastq file that the adaptors/barcodes have been removed from the read. If the fastq files still contain these primers how do I know it and how do I trim them.
Below and attaching a couple of reads from the fastq files:
@D5VG2KN1:206:C3LG1ACXX:8:1101:1216:2098 1:N:0:GCCAAT
CTTGACAAGCGCTTTCTTCAGAGTGCCCTCGCTCGTCCTATCTACAAAGCT
+
CCCFFFFFHHHHHJJIJJJJJJJFHIJJJJJJIJDHIJJIJIJJJJJJJJJ
@D5VG2KN1:206:C3LG1ACXX:8:1101:1437:2084 1:N:0:GCCAAT
TTTACCTTGTGTTAATTTTATTCAAAGCCAGAAACAATATGCATCCGGTTG
+
CCCFFFFFHHHHHJIIJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJHJJ
this is kind of basic but and I a newbie in NGS analysis.
thanks for any clues
Comment