SEQanswers

Go Back   SEQanswers > General



Similar Threads
Thread Thread Starter Forum Replies Last Post
Сollapse of Helicos genseq Helicos / Direct Genomics 19 05-13-2014 03:47 PM
Does anyone have any experience with Helicos sequencing gen2prot Helicos / Direct Genomics 18 09-19-2012 06:10 AM
Introducing Helicos tSMS™ Sequencing Services from Helicos Helicos BioSciences Vendor Forum 1 05-31-2012 05:49 AM
Helicos Nscore jmjensen Bioinformatics 0 09-22-2011 04:09 AM
Helicos AnamikaDarwin Bioinformatics 5 06-13-2009 03:01 PM

Reply
 
Thread Tools
Old 11-23-2009, 07:06 PM   #1
[email protected]
Junior Member
 
Location: india

Join Date: Nov 2009
Posts: 6
Default Solexa/helicos

Hi all,

I am graduate student from New York working on a project related to assembler. In order to get idea of how things work in assembler, I download velvet and i am trying to run it on different data types such as ABI solid, Helicos and Solexa.
I ran ABI solid on velvet and it worked. However, I didn't find solexa and Helicos data from the net. Could anyone upload some test data w.r.t Helicos, Solexa or point me to the right place from where i can download some sample data to run it in velvet.

Thanks,
Chandu
chandubobby@yahoo.co.in is offline   Reply With Quote
Old 11-24-2009, 02:51 AM   #2
Xi Wang
Senior Member
 
Location: MDC, Berlin, Germany

Join Date: Oct 2009
Posts: 317
Default

Quote:
Originally Posted by [email protected] View Post
Hi all,

I am graduate student from New York working on a project related to assembler. In order to get idea of how things work in assembler, I download velvet and i am trying to run it on different data types such as ABI solid, Helicos and Solexa.
I ran ABI solid on velvet and it worked. However, I didn't find solexa and Helicos data from the net. Could anyone upload some test data w.r.t Helicos, Solexa or point me to the right place from where i can download some sample data to run it in velvet.

Thanks,
Chandu
There are lots of resources on the website of NCBI:
http://www.ncbi.nlm.nih.gov/sra/

The Sequence Read Archive (SRA) stores sequencing data from the next generation of sequencing platforms including Roche 454 GS System®, Illumina Genome Analyzer®, Applied Biosystems SOLiD® System, Helicos Heliscope®, and others.

For example, you can get the sequencing data of an illumina run through:
ftp://ftp.ncbi.nlm.nih.gov/sra/static/SRX003/SRX003935/

Hope this info helps.
Xi
__________________
Xi Wang
Xi Wang is offline   Reply With Quote
Old 11-25-2009, 06:54 PM   #3
[email protected]
Junior Member
 
Location: india

Join Date: Nov 2009
Posts: 6
Default Regarding change of file formats..!!

Thanks for the reply..The solexa data was helpful..

On a separate note, I have some more questions..

1. I couldn't find helicos data in the above links...Could you please help with this..??
2. One more question is regarding the change of file formats (from solexa to fasta, from helicos to fasta).. Are there any scripts or tools for this? If yes, could you please point me to those resources or links..??

Thanks,
Chandu
chandubobby@yahoo.co.in is offline   Reply With Quote
Old 11-26-2009, 12:53 AM   #4
steven
Senior Member
 
Location: Southern France

Join Date: Aug 2009
Posts: 269
Default

Chandu,
You'll find Helicos datasets here (just need to open an account) or there. It's already in fasta format.
cheers,
s.
steven is offline   Reply With Quote
Old 11-26-2009, 06:41 AM   #5
[email protected]
Junior Member
 
Location: india

Join Date: Nov 2009
Posts: 6
Default

Steven,

Thanks a lot for the helicos data..

I have some more data which has to be converted to fasta format..So I need a converter or some scripts which basically converts from different formats to fasta format.. could you please help me on this conversion part..??

Thanks,
Chandu
chandubobby@yahoo.co.in is offline   Reply With Quote
Old 11-26-2009, 06:50 AM   #6
Xi Wang
Senior Member
 
Location: MDC, Berlin, Germany

Join Date: Oct 2009
Posts: 317
Default

Quote:
Originally Posted by [email protected] View Post
Steven,

Thanks a lot for the helicos data..

I have some more data which has to be converted to fasta format..So I need a converter or some scripts which basically converts from different formats to fasta format.. could you please help me on this conversion part..??

Thanks,
Chandu

What is the format of the data you already have? Could you please paste a head of the data here?
__________________
Xi Wang
Xi Wang is offline   Reply With Quote
Old 11-26-2009, 06:58 AM   #7
steven
Senior Member
 
Location: Southern France

Join Date: Aug 2009
Posts: 269
Default

If the answer is not in a previous threads (like this one or this one), i would suggest to open a new thread with a relevant title, specifying the formats you want to convert into fasta.
cheers,
s.
steven is offline   Reply With Quote
Old 11-28-2009, 09:33 AM   #8
[email protected]
Junior Member
 
Location: india

Join Date: Nov 2009
Posts: 6
Default

@xi

This is a first 10 lines of fastq file....I downloaded it from the net..this has to converted to fasta file..

@SRR015348.1 HWUSI-BETA8_3:8:1:441:264 length=32
AACGGACCCCTTCACTCTGGCCTCCTGTAGGT
+SRR015348.1 HWUSI-BETA8_3:8:1:441:264 length=32
YYYYYYYYYYYYYYYYYYYYYYYYYYYYYYTQ
@SRR015348.2 HWUSI-BETA8_3:8:1:861:561 length=32
ATCATCTCTGCCCCCTCTGCTGATGCCCCCAT
+SRR015348.2 HWUSI-BETA8_3:8:1:861:561 length=32
YYYYYYYYYYYYYYYYYYYYYYYYYYYYYYQQ
@SRR015348.3 HWUSI-BETA8_3:8:1:687:253 length=32
ACCTGCAGAGGCTCATCTTTGCAGGCAAGCAG
..........................................................................................

@Steven

I tried running the script which u mentioned with the following command
"perl script.pl SRR015348.fastq SRR015348.fasta"

it throws error saying that "No such file or directory at script.pl line 3, <> line 10600168"..

Iam giving the path correctly..But still it showing up the above error after executing the script for some 30-40 secs...


Thanks,
Chandu
chandubobby@yahoo.co.in is offline   Reply With Quote
Old 11-28-2009, 06:21 PM   #9
Xi Wang
Senior Member
 
Location: MDC, Berlin, Germany

Join Date: Oct 2009
Posts: 317
Default

Hi Chandu,

i find there is a script to convert fastq to fasta:
http://www.ringtail.tsl.ac.uk/david-...fastq2fasta.pl

i think you can check this script first. hope it works.
__________________
Xi Wang
Xi Wang is offline   Reply With Quote
Old 11-29-2009, 08:59 AM   #10
[email protected]
Junior Member
 
Location: india

Join Date: Nov 2009
Posts: 6
Default

@Xi

Thanks for the script..

I tried running the script using the following command..

perl fastq2fasta.pl xyz.fastq

It ran for couple of minutes.... and terminated successfully..

My question is .. Will it generate a new fasta file from fastq file..?? or will it convert fastq to fasta itself..??

I tried checking old and new fastq files after running the script...there is no difference..

And one more doubt is how can i identify fastq and fasta files..??

Please help on this..

Thanks,
Chandu
chandubobby@yahoo.co.in is offline   Reply With Quote
Old 11-29-2009, 09:43 AM   #11
ECO
--Site Admin--
 
Location: SF Bay Area, CA, USA

Join Date: Oct 2007
Posts: 1,355
Default

Quote:
Originally Posted by [email protected] View Post
@Xi

Thanks for the script..

I tried running the script using the following command..

perl fastq2fasta.pl xyz.fastq

It ran for couple of minutes.... and terminated successfully..

My question is .. Will it generate a new fasta file from fastq file..?? or will it convert fastq to fasta itself..??

I tried checking old and new fastq files after running the script...there is no difference..

And one more doubt is how can i identify fastq and fasta files..??

Please help on this..

Thanks,
Chandu
You need to capture its output in a file, as it's just printing to stdout. Try this:

Code:
perl fastq2fasta.pl xyz.fastq > xyz.fasta
ECO is offline   Reply With Quote
Old 11-29-2009, 10:11 AM   #12
[email protected]
Junior Member
 
Location: india

Join Date: Nov 2009
Posts: 6
Default

I didn't notice that..

Thanks a lot

Chandu
chandubobby@yahoo.co.in is offline   Reply With Quote
Old 03-21-2010, 09:51 PM   #13
sundar suku
Junior Member
 
Location: India

Join Date: Mar 2010
Posts: 1
Default Help me on velvet

Hi all,

I am having some doubts regarding velvet :

I am just a beginner to velvet. I couldn't able to understand of differentiate shortPaired,short2,longPaired.

What are all the parameters are neccessary to run properly?

I would be wonder if any one of u peoples help me in this,

Thanks all..............
sundar suku is offline   Reply With Quote
Old 09-30-2010, 08:29 AM   #14
labunit
Member
 
Location: Giessen, Germany

Join Date: Sep 2010
Posts: 10
Default

I don't know wether there is still any demand to know an easy way to convert from fastq to fasta but here it is anyway:

Code:
egrep -A 1 "^@" file.fastq | tr "@" ">" | egrep -v "\-\-" > file.fasta
The first part greps the lines beginning with @ plus the next line (-A 1) which is the line containing the read. The next part translates the "@" into an ">" to comply with the fasta format. The final part greps (-v: inverted grep) only the relevant lines for the output file. Without the last part annoying lines containing "--" would appear in the fasta-file.
labunit is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 02:48 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO