SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
MiSeq Custom Sequencing Primer Tm? pmiguel Illumina/Solexa 43 11-12-2015 12:52 PM
Miseq Custom primer for 16s V1V3 region lmma Illumina/Solexa 12 02-26-2015 02:13 PM
MiSeq custom recipes ScottC Illumina/Solexa 7 08-08-2014 05:51 PM
MiSeq custom libraries jhi_pete Illumina/Solexa 5 04-16-2013 09:55 AM
custom sequencing primers athos Illumina/Solexa 5 02-04-2011 11:47 AM

Reply
 
Thread Tools
Old 07-01-2013, 12:42 AM   #1
barturas
Junior Member
 
Location: Lithuania

Join Date: Jan 2013
Posts: 2
Default miseq custom primers

Hello,

Recently I had a sequencing run on Miseq with custom Read1 and Read2 primers and Im not very happy with quality of basecalls.
Miseq generated ~700K cluster/mm^2 but Read1 >=Q30 was 88.2% and Read2 >=Q30 71.5%

Could it be the case of not efficient annealing of primers?
Tm of my custom primers:
Read1 77.6C;
Read2 79.3C.

Native illuminas primers have following Tms:
Multiplexing Read 1 Sequencing Primer
5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 77.5C
Multiplexing Read 2 Sequencing Primer
5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC 79.2C
Multiplexing Index Read Sequencing Primer
5' GATCGGAAGAGCACACGTCTGAACTCCAGTCAC 79.2C


My custom primers have almost the same temp. properties.

Do you guys have any ideas or recommendations how custom primers should be designed?


Thank you very much!
barturas is offline   Reply With Quote
Old 07-01-2013, 06:46 AM   #2
JamieHeather
@jamimmunology
 
Location: London

Join Date: Nov 2012
Posts: 96
Default

I wrote a blog on it here, when I was looking at doing this.

If you do a search on this forum you should find several threads talking about just this.
JamieHeather is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 08:29 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO