![]() |
|
![]() |
||||
Thread | Thread Starter | Forum | Replies | Last Post |
ATAC-seq primers | Fasteno | Sample Prep / Library Generation | 12 | 04-09-2018 11:51 AM |
ATAC-seq with 2x150 | kevin199011 | Sample Prep / Library Generation | 1 | 03-14-2018 10:55 AM |
ATAC-seq protocol | wen yuan | Sample Prep / Library Generation | 69 | 02-22-2018 08:01 AM |
On-Plate ATAC-seq | krutipedali | Sample Prep / Library Generation | 2 | 02-28-2017 04:16 AM |
![]() |
|
Thread Tools |
![]() |
#1 |
Junior Member
Location: California Join Date: Apr 2018
Posts: 4
|
![]()
HI,
I'm a little confused how to orders the primers too: Just to be sure if I understand: For each sample: I will need: Sample1 Ad1_noMX: Ad2.1_index Sample2 Ad1_noMX: Ad2.2_index: etc In terms to order the primers if I follow the list from (Jason D Buenrostro paper): I should be order: Ad1_noMX: AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG Basically the second primer I have to put the index sequence to order: index+sequence? Ad2.1_TAAGGCGA: TAAGGCGA-CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGGAGATGT Thanks |
![]() |
![]() |
![]() |
Thread Tools | |
|
|