SEQanswers

Go Back   SEQanswers > Applications Forums > Sample Prep / Library Generation



Similar Threads
Thread Thread Starter Forum Replies Last Post
ATAC-seq primers Fasteno Sample Prep / Library Generation 12 04-09-2018 11:51 AM
ATAC-seq with 2x150 kevin199011 Sample Prep / Library Generation 1 03-14-2018 10:55 AM
ATAC-seq protocol wen yuan Sample Prep / Library Generation 69 02-22-2018 08:01 AM
On-Plate ATAC-seq krutipedali Sample Prep / Library Generation 2 02-28-2017 04:16 AM

Reply
 
Thread Tools
Old 04-03-2018, 03:35 PM   #1
Laiumiunix
Junior Member
 
Location: California

Join Date: Apr 2018
Posts: 4
Default ATAC-seq

HI,

I'm a little confused how to orders the primers too:
Just to be sure if I understand:

For each sample:

I will need:

Sample1
Ad1_noMX:
Ad2.1_index

Sample2
Ad1_noMX:
Ad2.2_index:

etc
In terms to order the primers if I follow the list from (Jason D Buenrostro paper):

I should be order:

Ad1_noMX: AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG


Basically the second primer I have to put the index sequence to order:
index+sequence?
Ad2.1_TAAGGCGA: TAAGGCGA-CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGGAGATGT


Thanks
Laiumiunix is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 09:03 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO